Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07E11.3   

sjj_W07E11.3 RNAi JA:W07E11.3
Simmer:W07E11.3:Repeat_a
Simmer:W07E11.3:Screen
PCR_productsjj_W07E11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W07E11.1 Source_evidenceePCR234WS150 Sequence/Annotation Release
W07E11.3a Source_evidenceePCR321WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR228WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript W07E11.3a Source_evidenceePCR587WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR496WS150 Sequence/Annotation Release
W07E11.1 Source_evidenceePCR234WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07E11.31497ttgaaaatagtgtgcctcgttttctgacctaatctggctaaaatctgaaattcagtgccagtagtcgtttcctttgttcgcgaagaaaacgtaagacttggttaacagatgggctattattccatgcggaacccaaccactttattcgaagttataggaaacatagtttaaaaaatgttgttgcattgaaagtacggatcaaaatataggacgagaatgggaagaaaatgttggaatatctaatatgatgttggctgagtagtggggttcaccgtgcattgaatcattgataggatggagttattggaagtcgtaatctggcagcggattgaatcgttttccgaaactgaaaataataaaataaattctatcgatctgcaagtgtattaaacatttttgtaagaagtgattctagtaagaatacatgacgtttccaaatatgtgtttgggttttaagcttgatttatgttgtttttccaaattttgaaaaaaattcggaaacttttaaactacttgatatacttcatatcatcaattatctctcatactcaccgaatgggctcgcgcggggagcgtttgccaaaacgaatgggttctccacgaagacgttttgccattgctgaagcttcgaaaattccaagagtgttgtcgttgacagctggctgggcgacagtagtaccctttaaataagctagttggccacgtaataactgatcccgactagtgggaatggggagtatccgctttggttgcacaaactggaagggacttacaatgacggcgagaaggacgaggaaaagagcagataggattccagaaacttgcatggtttgcgacaattggtttggcaacgactgacaatgagtcagacgaaagctctgtgtgcgggtgtgtacctgaaaatggagagctttttcacacgagatcgtttttggcaagagatagtaaaacgaagagcagatagaaatgtagagaaagtgggtgatgcgtgctcattagctcgtacagatcggattacaatgtgaactagcgtcaaagagcgttgggcgagagcagttgcgcaataacatctcatcatgtagaaatggtgattttgagtgaagacgtgaaagatcagactagtgaagcacgcgcaaaagtctccagaggaattaaatgaattgcaataaataagttattttaattataatcaatgtactttacaggatcgtctcaaacccggacgcatgctccttgtggacacacatctcaaaaagatcgagctcgatgaggaccttaagacaagaattgctttgtcaagacctcataagcaactttccgcatcgagaatctacttggacttgattcgcaaggatgatgtggttagtagtaaaagacaaaaaaaaaattgaattgtgacaaattttaactaatttttagctctctcacggtgccgtcaccaatgaataccttaatcgtcttcatttggagcaggtgaaccctggtcttatgaagaaa