Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07E6.1   

sjj_W07E6.1 RNAi JA:W07E6.1
Simmer:W07E6.1
PF:GL1_2B9
PCR_productsjj_W07E6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W07E6.1 (3)
Overlaps_transcript W07E6.1.2 Source_evidenceePCR719WS150 Sequence/Annotation Release
W07E6.1.3 Source_evidenceePCR717WS150 Sequence/Annotation Release
W07E6.1.1 Source_evidenceePCR719WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07E6.1906gagcgagttggctctaatggttactggtctcggattgtcgttagcctccaaaaactccaatagctccgctccatttgggaataaatccatgaattttcccattaaatagtcattgtatccatactgtgagcatagatccttcttcagcacttctacatagttttcacgcgatttctgtggatctcggcgattcttgaagtctccaagaacctggatgacgtcggcaatacgctgcttcacaatttccaagtttggcacggatttcatctcattttcaatctcctcgacggttggaagctcgaaagtcgcttgatttgcgatgtttagctgcaactcttcctctccttcagcgataatcttctccttctgcttgtcgagagccgcggattttttctcgattggcagatgatctccggcgtcggaatctggaaaaaaattttaatttcagggttttcagatgttcccccataccatcatcggaatagtcatctctgagatcttcatcgtcacttcctgggaagctgagaccttccaggccgtcctcgtcatcgtcgataagctgcagcttctcgacctgctcgattggttcctcctcatgagcctttttcgccgatttcttcacctttttcactagcttcttcttctttggagtcactgcctcggtttcctaaaaaattggagcttcgtcgtgaatgtttagtgcaaaaactcactgcaacaggtcttttaacggctttcttaacttctggcttctctgtagcagcttttgaggcagcggacaccttcttcttcttgacaattgccattttacctgaaaaatacttcttaaagtttgaaaaaaacgcagaaaatagtgacagaatggcgagaaaagtgaaaaccccaattcctccgcttgagactgat