Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07E6.2   

sjj_W07E6.2 RNAi (2)
PCR_productsjj_W07E6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW07E6.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
Overlaps_Gene W07E6.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
Chunk_score Abs_score646
Max_abs_score646W07E6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII482818484360
Overlaps_transcriptW07E6.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07E6.21543tcagtttgcgcatttcaaagtgacatccccgtcgttgaattttcaacgtttttaaaaaatattttcaagatttttcacaacttttcctgcaaaaagttacctgagatccggaataaataagtccttcgcctccccaacgcagacaggtgaccgaagcagtgtgtccactcaaacagcgaactacagtaccctgtacggtatcccaaatgaaaatatttccgtcttttccacaagaagccagaagcctgcacgtcgggtctttgtgcatcggttgccatgccaaactgcaaaaattttattataaaaattcgatttgaaatggaaatgtttagtttttatgttgaaaaattaatttttggctaatatttgagagaaaaactcgggttttctgaagctttctgttaaaaatcacatttttccactatggatgataagtaaactcatagaaaatattaaaaattcgatttaaaatacccaaattattggaattcgaaatgggtctgctagactacaaattacaaatttcgatttagcagacccaagtggttttgaagaagtttgggtctgctagactacaaactacaactttcgatttagcagacccaagtgattttgaagtgattgggtctgctagactacaaactagaaatttcgatttagcaaacccaaataatagtgattttcaaaagggtttcagtaaaaatacatcgtttcagtggggttttaatggaaattttaagagaacattgtagtgataaatacaattttacggcgattttttgtagaaaacccaaattttcaagacatttcagtgataaatgcgattttcctgcacctcgtgatccattgcttgtgccttttgagcgtttttccgatttgctctccggttttcgcgttccaaatgcaaatttctccgtttttgcaagccgaagcgattttcgtagcatccggtgaccaggcgatgcagagaacccaacttttatgggatttacacgtgtggagaggcaactcgagctcaatatcccagattcgcattgtttgatcgccggagcccgacgctagaccacgtccgtcagggctgaactgagcagagattactggctctccgtgacctgaaaaatatatttaaatgcgtcaaaacgatcaaaaaattacctggaatgctagcggagcatctggtaactggtctcacacggaacactgcttgtggctgataaacaagctttaatgtctgaaattttaaattttttaaaaagttttctatcttctttcaagggcttacagtctcaaaatcaatttcctctaacgattttcgaatggaatcgacaatttcagcgccttctgtggtgaagaaggaaatcggcacaggatcgtcactgaaaactcaggatgagatacagaaaattcattattcaaacaaaacctgctcccgagaagctgattacacaaaatttgcagctcattcgtggagatgtccactggaacaaggattcccgatcctccgagctcgttttcgtcctctgacacgaagctgaccgagatt