Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W07G4.6   

sjj_W07G4.6RNAiJA:W07G4.6
PCR_productsjj_W07G4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW07G4.6 Source_evidenceePCR984WS150 Sequence/Annotation Release
Overlaps_Gene W07G4.6 Source_evidenceePCR984WS150 Sequence/Annotation Release
Chunk_score Abs_score857
Max_abs_score857W07G4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1305305613054748
Overlaps_transcriptW07G4.6 Source_evidenceePCR984WS150 Sequence/Annotation Release
WB_DNA_textsjj_W07G4.61693catctttggcattctgagcattacacattttatgtgacatatgtatgttaaagttttcaacactcgagagaaagccaaataatcaaaaaccacaaaacatcccccacaagggttatgaaatacctacctgatcatctccacatgtttgcagtacatcgtcatgcattaaaatttcagcggtttcctggatctacaaatgtcttatttagttttacatctttgaataatttgcaagaacttacattactctgaacttttgctggtggcgataatccagcaacagtaattcccatacaaacaatagtccatccattgagaagaacatatatagctggatccataacagatttgaaacttccaacaatatatgcagcatttacaaatgaaattaaagtaaataatggtacaagtgaaccgtatttgctcatttgttggttcacaaatctggtgagttgaattagatccgagtgccgtttactgtagttatttaacacttgaggcagctgaaatttggatttactacaataaaatgataagaatcaataccgtaagttgttgaaatcttgcactatttgttagttctttattgaaatgtttgatttctcgattcaaagctgtatttactgtgacataaataacaactgcaagtgcagaggcaatacatccgataaagtcaatgaatggtgctagctgatggaccacggaatcagaatagaatgtgctgaagttgtatagagttaggaacaatatattataggtgtgtatttgatggaattttgataaagaacggcttacaacctgatggacttccaaaattatgataggttaaaactgagttttcaccactttcaacactgtaaaacagtagactgtaaaacgaaatattttcgaaaattttctttaaaaggtttcttatgatatgtggtaattttcagtagtatcaaataattttcccgctgacgatactccacttttaacctaaaatagccttttctcattagaccccttcctcattgaacaggtcaataaacaaatatttacatgcccagtcagatgttttccaatgtatacaaaaacctaataccatttttgaaataaaacacattcaaacttacgtagaatcattcaacatgtaccgattggtaacagaagaataaaatgaagtgcttaaagatacgacaaatattggaataatcattattgcagcttttctgtgataagtcgtatagtcatcaatgctttgacttgtcgataatctcattgttcttaatcgagcaagtgtgtcttcaaactgggacacaaatccttcacgagtccagcacattactgaaattgcactgaaaaatgcttgcactgccatgaaagcatagactgttgattctgcccaaccaattgaaaatgactgaaaacaaattattcgcatgctttatattctgaatgttacttactttatcttcaatttgcattaatacaataattttgatgatagagataataagaatgattactgctacacctccggttagtattccttttactgatcgtatgctttcttttcgtaatttatgacaatctagtccagagaatctaaaaacgtatttaaattatcctccccgaagagacacaaatgttacctgacaagtggttcgaatggtccgagaagtttgggagctggcggagatggtagttgtgt