Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W08E3.3   

sjj_W08E3.3RNAiJA:W08E3.3
PCR_productsjj_W08E3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW08E3.3 Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene W08E3.3 Source_evidenceePCR780WS150 Sequence/Annotation Release
Chunk_score Abs_score738
Max_abs_score738W08E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1334211313343780
Overlaps_transcriptW08E3.3 Source_evidenceePCR780WS150 Sequence/Annotation Release
WB_DNA_textsjj_W08E3.31668cttcaattcattgatggtccacttgataaagttgagaagcttttcactcgtgccaatgataaaacgaagaaaattgaatacgatacacttgtccgagtgaaaaagtgtttggaagagaaaaaaccagttcgtcaagagctctggaacgagaaagaaatcgaaattctcaacaaacacctcttcctgaccgccaagccaatcgtttacttggttaatttgtctgaaaaggattatattcgtaagaagaacaagtggcttccaaagatcaaggcatggatcgatacgaatgacgccggagcagtactcattccattttctggagcatttgagctcaaacttctcgatatgccagaagatgagcgtcaaaaatatctcaaggagcaaggagtcacgtcgaatcttgataaaattgttcataccggatacaaagctcttcaacttgaatatttctttacttctggagaagatgaggtgaaagcatggacaattcaagttggaacgcctgcaccaaaagccgcaggaagaattcatacggatttcgagaagggtttcattatggctgaagtcatgaaagttgccgatttgatcgagttgggagatgaggctaaggtgaataatcgatcgatatctggagtttcagggattttcgcctgaaaatacgggtctagaagcgactttaaggagtactgtagtagcttttcaagttttttccaaaattgttatgtattttttataaatttgcacatgtttttcaaaatttattggaaaacgtggcaattaataaaaatacactagattttgaataaaatggagaaaaccctgaaaaaaactagctcctacagtactcctgaaaggcgcacactctttttcattctagaaaatcgatcgctgcaagacccgctaccgtatttttgcagcaaaaatcacaaaaatttgctttttttgtgctgaaaatcttcaattttaagttcgatattctaattttcactaaaaattaatctagaaatataaaaaaatcattgattgatccgaaaataataccaattttcattgaataattcgaaaaaggcctcaattagtgcctggaagttagaaaaaaatgtcgtttaaatttttttcggctgaagacaatttccaggcactatttgaggtcttttttcgaattttttttaacaaaaatggattttatttcgaatcaatcgatgatttttctatatttttaatattaatttttgatttaaaaaaaagaaattttgaataaaaaataaaaataaataatgtacccggtctcgacacgaaaattttttgttcaattcgaaaatgcgtgcgcctttaaaaattactgtaatcgcaaattttcatcgatttttcatatttttcgataaaaattggaagttacagtaccctttaaaggcgcacaccatttcgcatttacgaaactttgtcgtgtcgagaccgaaacttcgctactaacaacaaatcaattcaaattttcagtgcaaagccggcggcaaataccgtcaacaaggaaagacgtacattgttcaagacggtgacgtcatcttcttcaaattcaatgccggagccggtcttcaagccaagaagaagtagaattggaaaatttcccaaattgttcattgcccggggttcccaaatttcctgtttagt