Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W08F4.3   

sjj_W08F4.3 RNAi JA:W08F4.3
PF:GL1_8H3
PCR_productsjj_W08F4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W08F4.3 Source_evidenceePCR767WS150 Sequence/Annotation Release
Chunk_score Abs_score683
Max_abs_score683W08F4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII580283581893
W08F4.8 Source_evidenceePCR47WS150 Sequence/Annotation Release
Overlaps_transcript W08F4.3.2 Source_evidenceePCR706WS150 Sequence/Annotation Release
W08F4.3.1 Source_evidenceePCR767WS150 Sequence/Annotation Release
W08F4.8.1 Source_evidenceePCR47WS150 Sequence/Annotation Release
WB_DNA_textsjj_W08F4.31611acttttgtttttcttctcggtccttctgtggcaatgcgcgtcagatatggtgttttctgtgtgcttctgcgtcacggtgtttgcacacaattcctttttcgctgatttttttaattttcagcgcgctgcagcgccatttcttgcatttttcaagcatttccattgatttttccgcgaaaaaacatctgaaatttcaaaaaatcaatgttaaactcacaatttttcttcttcgcactcgctgtccctcttgaaaactcgcgaaatgactgtatttcctttttttttcacgcaaaatttccaaatttccatgttttcagggtagttcaacacgtgaaaatggctcttctcacctcaaagcttcggtatcttctgctcttctacgcagtcttccaggctgctcaatttggcctccgctggaagtcttatgacatctcgccgaagcagttcaagactatcgctggaaaggctgctggtgaggaaaaacatatttttctgcgaaaataccgcaattttaatatattgtatattttcagctgctccaacaatctcccagtcaatttccacattgacgtctggaatgcgcacttattacgagccaatcatgccaagtcacttcgaatggcacgctattcagttgggaggcctcactttaagggtgaggaacaggaaaaatcgaaaaaaaatcttaaatttaatgaattttccagatgtacccaatgctgaccgctttcaccgagttcgccgccgccttctccgctccgttcccaacttcaggacgcccggggctccattgggcaaatacgacgtgcaccgtgttgaaaggaaaagtcagccgattcaatgacggaactcaggacgagacgtcggagaactttgcttcgggagccgctttcaggcacggacagttcgagtcccacgtgtacagcttcgagaaggacacctacgtcgcgtgctacggtaaattacaccgaaaatcaaggaaaattcgtttttttttgagtctggcagaccaatttcgaattaaaatcacctgggtctgctaaatataattttgtagtttgtagtctagcagaccaatttcgaaatcaaatcacttggtctgctaaatataattttgtagtttgtagtctagcagaccaatttcgaactgaaatcgcatggtctgctaaatacagttttgtagtttgtagtctagcagaccaatttcgaattgaaatcacttgggtctgctaaatataattttgtagtttgtagtctagcagaccaatttcgaactgaaatcgcttggtctgctaaatataattttgtagtttgtagtcaaccagacccatataaaaatcccctcgtttctaatgaatttttatatttttcaggtcgcggcttcctcccactctcctccaccgtccacgtcacctctggaatctcactcggcgagccactctcggtcattcaattctacatgaagcaggcctacaactactggaacaacctgagccacaccctctatcgtgtcttccagcactacaaggcccgcgccactggagaactttaaataatttatgtgattccccatccggtgcatttctacaagcattctaacccgaaattttc