Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W08F4.7   

sjj_W08F4.7RNAiJA:W08F4.7
PCR_productsjj_W08F4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW08F4.7 Source_evidenceePCR361WS150 Sequence/Annotation Release
Overlaps_Gene W08F4.7 Source_evidenceePCR361WS150 Sequence/Annotation Release
Chunk_score Abs_score277
Max_abs_score277W08F4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII576271577870
W08F4.8 Source_evidenceePCR34WS150 Sequence/Annotation Release
Overlaps_transcript W08F4.8.1 Source_evidenceePCR34WS150 Sequence/Annotation Release
W08F4.7 Source_evidenceePCR361WS150 Sequence/Annotation Release
W08F4.8.2 Source_evidenceePCR7WS150 Sequence/Annotation Release
WB_DNA_textsjj_W08F4.71600aaaatatcgattttcggcaaagttacaaagctttgaagttggtggcctagaatttcaaatttctaggccaccaacttaaaaaaaaatttgattgtgcaaaataattcgaaagctctcaaatgacccccataatggcaagcatcccttcttttcgaatttcattgggttccaccacgaaaagctacagtacgccccccccctttttcgtgccgagaccctccaaaatttaaaattgagggattctagtcaatatgggggtcatttaaaaggtctcggtgagctggactcgattttcagcaagaaaataagtttcctcactagtatccgtatatatcccatcaaaaagtcgaaccaaatatggcttgcatgtcttccagaatccggattgagattttagagcttccctgaaaattgttcaaattttttcaagctgaaaaaaattgaaaaaaaattacgaggtgatccatccgacattgataagtccaagtgaaagtgtagaactgattggaagtgtgaaaactataaaatatcgattttaaattagaacatattatgggatcacatgcgtactgcacaacatatttgacgcgcaaaatatctcgaagcgaaaactacagtaattctttaaatgactactgtagcgcaaggtgtcgatttacgggctcaatttttgaaattaataaaaataatttatagaatatttaaactaagtaaaaaataagaaaataattcgaaaataaattaatttcaaaaatcgagcccgtaaatcgacacctggcgctacagtagtcatttaaagaattaccgtagttttcgctacgagatattttgcgcgtcaaatatgttgtgcaatacgcattctaataacatttctcaaaataaaaattgaaatgtttgaaaaaaaaattaattctttctgaattttttgaacttttccaaaaactctgaaattgcagattaaattatttttaaatcagaaaatcaataactaacaagcattcatcacattatacgacgaagatccacaagtgacacctccagtcaggggtactgtagctgattggagcgtctcacagtaacgaatgacagttggggtccaatctggaaattatttttatttaagaaatcatttgtgtcacgtggtgtcaggctcttcccatcacggtttgatctacaaaaaatgcgggaatttttcgccctaaaatgtgacgtcagcaggcaaaatcagttgagaactctgcgcctcaactcccgcattttttgtagatctacgtagatcacgccgaaatggcacgttattgggtctgctaaatcaaaatttgaagtttgtaggctagcagacccatcctagactcacttccatacaagctcaattgtgccaaggaaaatgggacaaaaactagtagaataagccgcgaatttaccattttcagccaaaaaatgaccgataatacatccattattgaactttatagttgtcaggcggagactaacgtttgcttacaaaacatcactttcaaaaaatcgtgagaaaaaaaaacgaataaacacaataagaagaaagttgatgatgataatctttatgctattccgaattgga