Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W09B6.1   

sjj_W09B6.1 RNAi JA:W09B6.1
Simmer:W09B6.1
PCR_productsjj_W09B6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW09B6.1b Source_evidenceePCR1195WS150 Sequence/Annotation Release
Overlaps_Gene W09B6.1 Source_evidenceePCR1195WS150 Sequence/Annotation Release
Chunk_score Abs_score1174
Max_abs_score1174W09B6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII11458371147031
Overlaps_transcript W09B6.1a.1 Source_evidenceePCR1195WS150 Sequence/Annotation Release
W09B6.1b Source_evidenceePCR1195WS150 Sequence/Annotation Release
W09B6.1a.2 Source_evidenceePCR1195WS150 Sequence/Annotation Release
WB_DNA_textsjj_W09B6.11195cacaatattgcgttcatcggacccccagctagtgctatgttcagtttgggagacaagatcgcgagtacgatcattgcgcagaccgtcggagtgcctactgtcgcctggtcgggatccgggatcactatggagagcatcgagcgatcccgtggagatttcgtcgtggtgccagaggatctgctcgagcaggcgtgtgtcgccaactacaaggagggtctcgaagcgctcaaaactcacaatatcggattccccttgatgatcaaagcgtcggagggtggaggtggaaaaggaatccgaaaatgcaccaaagtcgaggacttcaagagcatgttcgaggaagttgcccaagaggttcaaggatccccgatcttcctgatgaagtgcgtcgatggagcgcgccatatcgaggttcagctcctcgctgatcgttacgaaaatgtgatttccgtgtacaccagagactgctcgattcagcgacggtgtcagaagatcattgaagaggcaccggcgatcattgccagcagccacatcagaaagtcgatgcaagaggacgcagtgcgtcttgccaagtacgtcggatacgagtctgccggaactgtcgagtacctgtacctaccagccagtgagggtcaggaggagcactattatttcctggagctgaatccaaggcttcaagtcgagcatcccaccactgagatggtgtcgaacatcagcatccctgctattcaacttcaaatcgctatgggtctccctttgcataagatcaaggatatccggaagctctacgatcttccgattgatggagactctgagctgcccgacgaggtgttggtggatacgaagcttcatgcgatcgccgccaggatcacatgcgagaacccggacgacagcttccgtccatccaccggaaaggtctatgagatcaacttcccgtcgtcgcaggatgcgtgggcgtacttctcagttggaagaggatccagtgttcatcaatttgctgattctcaattcggacacatcttcacgcgtggaaccagccgaacggaggcgatgaatacgatgtgctcgacgttgaagcatatgacgatccgatcgagcttcccgactcaggtcaactatttggtggatctgatgcacgacgctgacttcatcaacaacgccttcaacacacaatggctggataagaggatcgccatga