Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W09C3.8   

sjj_W09C3.8RNAiJA:W09C3.8
PCR_productsjj_W09C3.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W09C3.1 Source_evidenceePCR63WS150 Sequence/Annotation Release
W09C3.8 Source_evidenceePCR841WS150 Sequence/Annotation Release
Overlaps_Gene W09C3.1 Source_evidenceePCR63WS150 Sequence/Annotation Release
W09C3.8 Source_evidenceePCR841WS150 Sequence/Annotation Release
Chunk_score Abs_score757
Max_abs_score757W09C3.8
Specificity_index0.691
Rel_score1
Map_statusUnique_ePCRI47161584717734
F02E9.8 Chunk_score Abs_score339
Specificity_index0.309
Rel_score0.448
Overlaps_transcript W09C3.8 Source_evidenceePCR841WS150 Sequence/Annotation Release
W09C3.1 Source_evidenceePCR63WS150 Sequence/Annotation Release
WB_DNA_textsjj_W09C3.81577ttcttctcccaacgacgacttgtcccgacatggcggaattgtggtggaattttgcgtattcttcgtcgatgtcctttgcccatctcttcttctgtcctccaacggcacgtttccaatttttgttgtggctcgggtcccattccgtgcagatttttgtccatcggtttgggtctctccgtagaatgtgtcctgcaaatcttgattgttttgcaaggaggtaacgttccaagttgaagttccagcctcgaatttctgcagcgtcgatgagaccggtgacagtttttttgagtctcaacgtggatccagcattacaagtccaagtttcactagcatacaggagggctggtagcacattttgcttgaagaggatgattctttccttgtttggcatgattctcaagacttctttgattccaaccagagcaccccaacctgctcttaaagtggaacactcaaatgtctcaaaagcagaactgaaaaatcaaacttgtgtgaagaattcagtctctcagtgctcctagaaatatcataagtttaatcatttttcagagtttgctcagcacggcaaatattggaaaaatatatctgccaaatttgccgagctcgtgtgatttgccgcataaccctgattcagacataatatgcttgttaatttccaacaaataaaattggtaggtttattgttttgttacaatgcttttataaaatttggaaattgctagagaggggttcattcatggaaattaaattgctataaaaattctcacaaaaatgtttttccagagaatatgctgagggaaaaggctttttcttgataaaattatttcatttattttcaagtattcaacaagaagtagtctttccagaaattaacttccaatcctttgaaacaacgaaacttgattgcaatttatcgaattgatcagaaagagaagttgcaaatttatagggtccagttgttacaatttcagtatttctttcaatcatataagctttttgttcatctactgcagagaccagtgtgatggtttcatctgaaaaataattcaatttcaaattaaatattgaaattcatacctttgttatacttcttcttgcatccttcataaataaacttttcatcgaaaacgtctccaattttgtgcttatcttttaattcgattcctttcaacaattcttgaatcagtttctctcctttctttacatcctctgggattttgacacttttcttggaatcgacaaggaaggagattgcaaagagaatgcacacgtgttgaagtttcattatggaaatgacgataaattggaaaatataattccacaaaagtagaatttttaaaaaacatttattcgaaaaggtcaattcaaaaacatcgtggttttctttgctgaaaatcgtcattactaaagttaagttcataatttttgaaattccaagaaattgaaatcgataagaagctgttgtcatgagtgaagaagacgataaaccggatagacaagtggaaagtattcggttgaatattggtgaggtacggtattctcgaattcttctgattttaaattgcgcgtgttttctg