Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W09C5.6   

sjj_W09C5.6RNAiJA:W09C5.6
PCR_productsjj_W09C5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W09C5.6 Source_evidenceePCR455WS150 Sequence/Annotation Release
Chunk_score Abs_score337
Max_abs_score337W09C5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1365284213653935
Overlaps_transcript (8)
WB_DNA_textsjj_W09C5.61094tactgttttcaagggaaaaacgacagaaaattcgagtgaaagcaacctctgaaacagcttctgttctcccccaacctcgaaaatcaaaaccttttttattaaaggtaacaacaattttattgaatcaacaatacttattcctcgctgtcaacgttgacgttggtgagtccgtggaagttggtgcatggaacgtaggtgcagagggtgtagagcttttgagcggagtcctcatcctcgttacggcggcgggagagacggacacgaactctgtatggaacgttcttgattcccttggaccagatgaacttgttgagcttggtgtcgacacgcacatcgttggtcttcatctggatcttggcgaacttcttgatctcgtcgatggcacgtggagcacgcttcttggatccgctgaaaacgcattattggataagaacttcgcaaaatcatcatttttacctctgatttcccgctatatttcaaccgaatttgaggatgcccctgagatctccgtccgattctcgaatgagaaacgaacggcgtttctggagagagccactcaccagaaaacgaggcgggtaagctccgttagtccggccaccgcggttcgggctagaacctgctcattaaagagctgcgatgacaggcgtgggccaacacaccgcttccaggtggagcacgtgttagcatgtgagcaggaaatttgagcgaaagatggaaaatagtgtaaacttacattcctctgatgcgggcgtggatgtgaatggtgtattcacgggtgacgacctcgttgatggtgctgcgggacttcttctcgttctttggagccatcgcgacttgactggattacctgaaaaatcttaattttaaaattaaactagaaactgagaacacaagaattataaggaaaaatgcataaaaatcatagtaggagctttatttcagagagaaaacatgataattatacgatttacacattgaaaaaatattttttaaatgaaaaaaaataaaaatttacgaaaaaatcacaaatttccattggaaaagcgtaaaaatttttaggataaaaatggaaaactccattgcaattccctaat