Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W09G3.1   

sjj_W09G3.1 RNAi (5)
PCR_productsjj_W09G3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW09G3.6 Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene W09G3.6 Source_evidenceePCR792WS150 Sequence/Annotation Release
Chunk_score Abs_score771
Max_abs_score771W09G3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1381661813817812
Overlaps_transcriptW09G3.6 Source_evidenceePCR792WS150 Sequence/Annotation Release
WB_DNA_textsjj_W09G3.11195aactagttttgaaagttgcagcgctcatcgatttttcttgcggaattccgctttatatgccattttctctcaagaattgagcacgtccggatatttttgaccaaaatcaggatttcgagccaattcttttattcatttccaaaatgttcagctacagtattatcaaaatatataaactgacatgtgaaacgtggcttattttttattttgttttttttttatttaagctcctcccattcctgacctttcgttgaaattttcatttattagttcattaaaaaatgggaggagcttaaataaaaaacaaaataaaaaataagccacgtttcacatgtcagtttatatattttgataatagcgctttattacccatctcgccaaatttttcatcgattcctcttaccttaacccctaacaaatccttaaacccaatttcacgggctcctatcacaacaatcgaacaccaatcagcgggcgccattcgccgggcaatatattgattttctgcggtaataatcgagattgtcgccttttttccgatagtaaaaacggaaagagcgagaaaagttcgcaacgggaccgcccgtgtccattgaagacacgtggcattaagaaaatcgatattttcgtcggtttcatcgattttaatcggtttttccccgggaaaatcgattttttgatcaaaatccttgcaatcttcaaatttcccaaattccctccgcatcacaattgcctctagcttttcccgactcgaattactaatacatcgctcgaaaatccgttcaacattcggccgaactccatcttctgccatcccgttggccgttttccacgcgtcgctgcaaactcgctccaccgtactcagcgacatttcacactttggacaaattgcttcctgtgatgacgtcacagatgcaacgtggcggagcagggtgctccatgctacgtggctctgcggaattgctccatttcgctgaaattcgtcacggagcacgtttgcaccaccgcacacagccatcagaagtgacgtggcagcccatgagcggtgcataccacacgtggcacaatttgatgatgacgtgggggtgatgacgtcatcatccagaggatttgtccaaatgtgctcagaagtcggtgtaggaccctcggagccggttgtcaatgtgtaatctgtgtcggattttggtacattgtt