Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W10D5.1   

sjj_W10D5.1RNAiJA:W10D5.1
PCR_productsjj_W10D5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW10D5.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Overlaps_Gene W10D5.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Chunk_score Abs_score691
Max_abs_score691W10D5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90984319099469
Overlaps_transcriptW10D5.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
WB_DNA_textsjj_W10D5.11039caggtgacattcaccaaacgaaagtttggattgatgaagaaagcctacgaattatcggttctctgtgattgtgagattgcactcatcgtcttcaactcaactaacaaactatttcagtaagttttaattgaattgggatgctagatattaaaataataacaatttcagatatgcctcaactgacatggataaggtattgttgaaatacactgaatacaatgaacctcatgaatcccgtactaataatgacatcatggaagccttgaatcgaaaagaaggcaatcagggaggcggaaattcggatgatgaaagccctggaccatcaacatcacctgtcattcaaataacaatgcctgctgttgttaatggacatagttctaataattcggtggcttctgcagcttctgcttctgctgccgctgttgcagcagcagcagccgcagttgcagcagttgagggaacatcttcgggtgcggctgctgcagcggctgcactacaagcatcaaatgctcaacgacatcataatttgaacttgtaccagaatttgatatttaatcccaactacactcgccatttgaaccaaaggtacggtttttgaatattttggtatatttttcatgtatttatttccagaaatgatcctctgtcctctacatctgttgctccttcctcatcctcatcaaaacatctcgattttcctccatcaacttcatttgcctatgacacgtcacgccttcatccaattgccgctgctgatgctgattgtgatcttgtaccatcatcaagagctgcagctgatcaaaatatttggtcatctgcattacaacaacgccctgtttcacagcctgcacctagtagtaagtttgtggaaattaatttttacaatatcaggcttaggcttagaacctatcaatttcaatgcgcaagtaatgaacaaaactaattttttggcacaaataggaaatagggattagaaataaatggtggatataacagaacgcattttaaccgattcatagtcggcatcctaagttcgaac