Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8A.b   

sjj_Y105E8A.b RNAi JA:Y105E8A.b
Simmer:Y105E8A.b:Screen_A
Simmer:Y105E8A.b:Screen_B
PCR_productsjj_Y105E8A.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8B.2a Source_evidenceePCR966WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8B.2 Source_evidenceePCR966WS150 Sequence/Annotation Release
Chunk_score Abs_score903
Max_abs_score903Y105E8B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1463522314637472
Overlaps_transcript Y105E8B.2b.2 Source_evidenceePCR80WS150 Sequence/Annotation Release
Y105E8B.2a Source_evidenceePCR966WS150 Sequence/Annotation Release
Y105E8B.2b.1 Source_evidenceePCR80WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8A.b2250ggatgttatcagccaaatgttgtagatacatcttccatagttcatctgcatacacttcacacaacacttggattggggatctgaaaaattcgaagaaatggcaaattttcaataatatgtctttgataataatgttcgtggtattaaaatgttaaatattaatgcggaaaatcacttcttttcttccaaacacacttaacatcaatttcgctactcacactatactattttacttaatactaatatttaggaaaaaaaattgtatctagaacaattaaagtgcataatttaatatatactgtgttagttaatacgtatagtgaattaactgtttagttaagtttttattcaacatagttaaattttacttatctatatatatactgatacgtatttatatgatacttatcactataatttaagaaaatactgatagttaacaattaaagcgtataggtattttaatatatgctgtgtgtgaatatatacaatactatttttggatttgttggaaacttttttcaaagaaataagaaagttgaattagtttttcaaattctactatgttatttaatactaaaaaggattaaaggattaaaggacgatccgttcttcaagtgctatgcactgcggatctgggattcaggtacactgcctggtggtgatgatcccactgggctataatttaagccacgtcctagccggggactgtggccgataatccagtcgtggattgctccacttcccaatagaggctgggtgaacctaggggggtgaggccggaattgaactcgtgacctccagactgctagcggccaccactaccgactgagctatccgccccctaaaaatattatgttgaacatataaagtgtatcaaatttaaatctatttttaaagtaataatttttagctttgaattaactagctttttttgtatgattatattatatgcaagactatattataactttgttgttagtcatacactgaacttgctagttttattaatcaaattttgtttctaaatcctatcaaaagactaacaatctaagcggcgccaaatccttcgaaagagtatgtgcaactttcgcaaaatgcacaacattctgcgaaacattcaacgagcttctcgattcatcatttgcagaaatcgcccattccacattaatcccaacatcggaaagctcctcaacgagtcgattcagtgcagattccgattccagcacgtagggcctccatttttcctccgaaatccgcattttcacagcatcacagatattttcaaagtttccttgtagagatttctcgaggggaatacttaaaagccgattgacttcgaaattcaaatgaacaccaattgcagtgagatcttccattgtatgcattacattcttccacgtatatgcaattacagcaattgcaggtgcaacttcaataacatgtcttctgatcaaattcaatagagtacttaattcataagaacaccattgaagtacttgacaatagtattgaggcattgatcggaattcatttgcaatatcagatactgcatttccatataatgtacatagttgctttacatatgatattggttcttctgatactgttacatcacgcattgcacttcgttgcattgcacttctccgtcttaaatagacatctgttgcgtaggttccacggcctaattgggttagaagagttcgggcttttttcatggctctcgggcctccgtgtactgcgccgggccggcttacatcgtcgctgagcagttggacaatctggaatgattttttgatatgagtcatttgaaactaagtttttggtatttcaatttttgttgataaacttttgtgaaagtcgaaaaaaatttctgcttgtaagaatttcgttcttgattttttgagaaatttttctatttttttttaaatttaaatttttactgattttctcttaaaaatgaacaaattttttggaaaatctagaaatctcttcgatttattttttgttgataatttttgaaaaatctttttaaatgggattttgcaaaatttttgaaattttgccaaattttcgaaattttctatgcaaaaattaccgtattctctctcatttgcaactgaatatcaattacagcatctttcgtcgggcactgtttccattcgtgaataagctcaacagcttgatcaaggtctcgatgagcaatgcaatcgtccagttctgccggaagttcggataaccaggaaatgt