Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8B.e   

sjj_Y105E8B.eRNAiJA:Y105E8B.e
PCR_productsjj_Y105E8B.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8B.9 Source_evidenceePCR457WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8B.9 Source_evidenceePCR457WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusTop85_percentile_ePCRI1467750614679743
Y105E8B.10 Chunk_score (4)
K08C9.7 Chunk_score (3)
F34H10.1 Chunk_score (3)
Overlaps_transcriptY105E8B.9 Source_evidenceePCR457WS150 Sequence/Annotation Release
Overlaps_pseudogene Y105E8B.10 Source_evidenceePCR462WS150 Sequence/Annotation Release
Map_statusBest_ePCRI1467750614679743
WB_DNA_textsjj_Y105E8B.e2238tcccatgatcttccattttcttaccccatatcaatataccatccgtagtatcgattaacacaaatgaaatccatcaaatccgcagtttgatcattatcgaagttcgtcggaccatacacagtagtcaccggacgagtacgatcgattccgtgagcagtgtccaccagagttctgaaaattctcctgttaatatgatactcaaaaagagtaactaacttgaaataattcctactctccttcttcatagtctgcggctcatttgccagagaccacgcgatgactgatggatggttcttgtctcgatcaatcatgtcttggagcattttcacgtgcaaattgttgttagctttggaaaatcccctggaaacgatctaagttggaaattccacggattaagggcatatcctactttaagccgacagctggtgtctccacaatcaccgcaatacctctacggtcattctcgaacattcgttcttcggaatatggataatgggttgttcggtagcagtttccacccatccattcgagtagattcaagtcttttgtcatgatagcttggttgaatccacggcctggaagatgttaggtgtagtttaggctaattcagatgttcggtataatttcgttactgatacttggcagactaaatgttccaatagaaaatggtttgaaaaaatagcaaaacctttttatattcgttcggtttctcagacaggtgcgagtcacggctaaccgactcaaaatcactgctaattagctttttgaccagggatagagtcaacctggctagctctggtttctcgctaattagctctggttttttgctaattagctctggtttttgataccgaaaatgaaacactttttttttgacagtttcccgcagttgttcccacctattataaccctgccgtcccattctgggataccgcgtctcccacatcttgctctccctgtcatgtccggctctgtttctgctcccaacccgctcttgtcaaatcaaatgtatttactggggattgaacccgcattgcttcacaccgaacgccgacgccttacccattgcgccgtcgcgcctcgtgtgaggcttctatcgaaagaaacttgaataacgagataattctcgtggaacacagcatctactccaccatccaaaatttgtttgcgtccgattttgtatgtcatcgatacaaattgggcgacaccatttctgaaaagcattttggagaactccttctccgaacattttgttcactatagtgttcactatagcacactaaaatcttgatgtatatatcaagattttagtgtgcgaggaaaagcacccaaacatcctatgtgctattacgaatcatcccccgaacaaataataataaaaaaaaacaacagttttattttgataaaaagctaacatttaatagtctacttctttccttccttctcgtttgaagtggcagcggcagtagaggtgtcaacgacaaggatgttgggacatcttccgtagtgtggtgggctgggtcatgaaggcttccctctgaatgctggctgttggtatccctgttggtagacggctgatcttgccgttctcgtcgatctgaaaatattgaaatttggttttggcaccatatcaagatattaatcgtcccaaactttctagctggagctgattcttctggaaatagacacttcgcttaccttgaagtacttgggggacggcgagcttgacttcctttggcttatattgttcttctttggaatggtgtagacctttttctttcttttcttggctcctccgagaagctcacagttgacgtagatggtagctgcagccttgattccacaatcgctatttcctagctgacaactgaaacaggtataaattattaatgcgtccggcagagtcgtactcaaagcagcccgaggaatgtcaagctcagcttttcgagaatcgacgtgaaaggaaaattaccggcatagcagagtctttgctcctcctctgtaataacatgtttctgtgataaataaaacaccagatagctctacctttacaagtggagccgtctttgaagggtgaaatgagtttctgcacaattgaggattttcgttgatttttcggcattagccgaacaaacatctgtagtttcttcctctttttcttctcttgagttgttcgtggctggcggcatgaattctccatcgtctagaggaacttccttttccccatttgaaatttag