Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8C.d   

sjj_Y105E8C.d RNAi JA:Y105E8C.d
Simmer:Y105E8C.d:Screen_A
Simmer:Y105E8C.d:Screen_B
PCR_productsjj_Y105E8C.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8A.17 Source_evidenceePCR887WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8A.17 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1446944214470929
Overlaps_transcriptY105E8A.17 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8C.d1488ttaattttgaattttcggggaatttttcgaataatttttgaatttcagatgattggcgacgttcatcagatcctccagagcacggaagcacccaaagatgccacgaaaaagccgccgaaacccggaacctcggctccacgaaagcctgaaggaatgaagagagagcttttcaacttgatgtcaggcaaggatttgactgcagtgatgcctacggatgtgaagaagacctataagcaaaagtttcaggttttttgagccgctaaaaatcgctgaaaaatgaaaaaatctgagtgttttcagacaggatttcgctctgttcggaagtataaatggatgccattcacaaatgagtcgcgggatgacggcctgatgcttcatcattgggttcgggccgacaaggtggaggccatgcagccttacccattttcaaggttcaataaggtaaattcagcatcatttttcggctggaaaatggcttttttttgctatttttctgcttccacgtgcaaatttttcttgagaaatggcaaattcactgatgtaacagtgaaaaaaattcagttttccgtgaatttcaacaaaaaattcgcgtaaaaacgaaatttacggggggtgaattgcgttaaaattacgttttttccccgaaaaaaaagcaatttttctcgcgaatttcacgatttttcaccgaaaaattcaaatttctcagaaaaaaaatgccaacttttcatttgattttcatatttctgaagtttttttgcggatttttcccctaaaaaatcgagtattctaccgatttctcatcaatttttggctgaaatttggaaaaaaaaccgattttaagtcaaattttctcgaaaaaccgaaaaaaaattcaaatttcaacgggaaaaatacgattttatctgaaataaaaattttttctatatttttctgcttccaggtgattgatattccaatatataccgacgatgagtatgaaaattacctaaaaatcgcaaaatggtcgcgggaagagactgattatctattcgacacgtgccgaatgttcgatcttcgctggccaatcgtctacgacagatttgattgcaaaaagttcaatcaaaatcgcacagtggaggatttaaaagagcgcttctactcgataacctatgagctgggcattctaagagatccaagctcatcaccgacggcttatgatgcagaacacgagcgtcggcgtaaagaacaactgaataagcaatggaatcgaacggctgagcagcttcaagaggaagaagatctcactgcagagctcagaagaattgaattaaggaagaaagagagggagaagaaggctcatgaccttcaaaagcttattaatatgtctgaacagcagcctgctagtccgtctgcagggggtattggaggggctgcaagtgcaaagaggaagaatgcgtttagaacgaaagctggttcgatttcgacgacggctaccactttctttaatcc