Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8C.e   

sjj_Y105E8C.e RNAi JA:Y105E8C.e
Simmer:Y105E8C.e:Screen_A
Simmer:Y105E8C.e:Screen_B
PCR_productsjj_Y105E8C.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y105E8A.16 Source_evidenceePCR583WS150 Sequence/Annotation Release
Chunk_score Abs_score514
Max_abs_score514Y105E8A.16
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1446857114469410
Overlaps_transcript Y105E8A.16.1 Source_evidenceePCR583WS150 Sequence/Annotation Release
Y105E8A.16.4 Source_evidenceePCR332WS150 Sequence/Annotation Release
Y105E8A.16.2 Source_evidenceePCR583WS150 Sequence/Annotation Release
Y105E8A.16.3 Source_evidenceePCR339WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8C.e840gcgcatctggaattaagaaattaaaatggtttattttggaatttagaagcttgaaaaatttacctggaagcgatcccaggtcttggatccctctccgcatggggtcttgcgggtggtgatgcggagcaccttggtcggcatgcggattgggcccttgacaataaggtgctcgttcttggctccgtcgatgagctgagcgcagactgaaaacatagagttgaggtagttgcaacaaaaattgaaactgaaaacctacccttctcaagcggcttaacgttttgggaggtcaaggtcagacggatgcggtgctccgaattgtcggtaatagccttctcattcttgaaagcgacagcctggaaaaaagcaacttattaaaaacaaaaggtaattacaagtagaaaatcccgaaaatcgataataaaactcaccatggttgattcgatgtagaatttaaagagctttgaaggtctgctatcttttgattttagcctttcggtgctctatttccagtttgaagctgaaaaattaataaaaaatgagattttgatgaattctggcatagaaaataggttttattaagcaaaaatatcaattttaagtcaaaaattgattaagaattcaaaaatttccgcataaaaatcaaaaaatccgctgaaaatcgagaatttttgaaaaaaaattccacaacccaaaaagctggcaatggttaaacgttgaatactcagccaactctaccgtacccccacaaacctgcgtatctaacagccaaatgtccaatggggcgcatttgcataccaccattattttttaaaaaatattttaatttgcaggcaatttttg