Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8C.k   

sjj_Y105E8C.kRNAiJA:Y105E8C.k
PCR_productsjj_Y105E8C.k
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y105E8A.10a Source_evidenceePCR834WS150 Sequence/Annotation Release
Y105E8A.10b Source_evidenceePCR834WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8A.10 Source_evidenceePCR834WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792Y105E8A.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1442813214430327
Overlaps_transcript Y105E8A.10b Source_evidenceePCR834WS150 Sequence/Annotation Release
Y105E8A.10a Source_evidenceePCR834WS150 Sequence/Annotation Release
Y105E8A.10c.1 Source_evidenceePCR834WS150 Sequence/Annotation Release
Y105E8A.10c.2 Source_evidenceePCR834WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8C.k2196cgtgacgacggtcttttatactcctggttgacgaggattggcgggcagcaatccgaggcgaattgagcgcgccgtccaacggggcgcgtttgcatcgagtacggtagacaggtagcaggcctagtcgttgttgttggcagcggtgacggccgaatgcagacatgcattcgctacgacgacacttgctggacctggaaaactagactgaagtaatgctcttatattggagaggtgggaaccggaaaatccttacaaatacatataaagcgcatactttataacagtgcaatataattgcattacaatgataatacaatataataaatacataatgcatatatactattacaataattatagtacaatatataatacatacattataaaattgcagccgaccaagtatatcactcaatcgaaaaacccacaagattccatatggaaggagactgggcgaacgtgaaaaccgctagccgcgtacctcatgacctcggaaatcccgccgatgagccatggattgccacaaatgcctatgtgatgcatgatactgggaaatggaaagatctcaatatgaagtatgtattaacgtcgtggcgagattacgtagtcctctcgaatgaacacgaggattttctatttcatacgtggccggcggtacggatgattatgcttgaagcactggagaattgggatcaagatggcgatggaatgattgagaacttcggaaaagcagatcagacttatgatgcgtggcaaatggagggtgttagtgcgtattgtggatccttatggctcgcttctcttcgagttgctattgaaatggccgggcttatgaaggatgatgagactcagcagctgttcaggtgtgcggaatgaattgatttttgatgaaaaatgcaaaaaaattggaagaaaattggttaaaaatgacggtttttgcttgacacccgagtttggtgaggctgagcgaagttgtagtttgtagtcggagcctcaaccaaaagttttcttgtgtttttgagcgttttcgacggaaatttacatgattttcggcgttttcctcgaaaaagtttttaaaaaatcgtaaaaataggctgaaactttaaaattgagcataacaattcgtttggtgaggctacaattttgtagtttgtagtgatagtctcaaccaatcgtttttttttgttgtttttttttgttagaaaatttaaaaaaaattgaagaacaacaagagatttatcaaaataagttgagtttaatggaaaaatgctcaaaaaccgaaaaaaaaacgtattggttgaggctcagactacaaactacaaagttttagcctcaccaaattgaaatttccaagctaaaatctttattttcaccaatttttacggactttttcgttgtaaaatcataaaaatgaaacaaattcaaacatttaagttaattttatcggaaaacgtcaattttataattaaaatttttccatttttccgattttttgattttctctgaaaaacaccataactttaaaaaaaaactcaaatttaaattttcacgtggtgtcaggttgtcccataaaggtttgatctacaaaaaatgcgggaatttctccacaaagaaatgtgacgtcggcatgcgaaatcagttgagaagtctacgtctgaattcccgcattttttgtagatcaaaccgatatgggacaacacctgacaacacgtgaatttttttgcaatttttctttcatttgcgaatgaagtttttaaacgaaaatttagaaaatcggaaaatcggaaaatatttcgatttttatacattactttatcattttttttttcaggaatactctcgaaaaagcgaaaaaggtattcatcgacactctatggacaggaacctacttccgattctgtgagcgatcccgtagtagagaaacagtgatggctgatcaactatgtggttattggttccttcaatcagtatctcctgaactagccgacgagcttctcccgaatcatatggtccgatcagcgttggatacgatttatcgattgaatgtgtgtaaatttggaaacggacgaatgggtgcagtaaatggaatgaaaccgtcaggagtcgtagatcgggagtacattcaggctgatgaaatgtggacgggtgttacttatgcagttgcatcgttacttattcaacagggagaagtggaaa