Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y105E8C.s   

sjj_Y105E8C.s RNAi JA:Y105E8C.s
Simmer:Y105E8C.s:Repeat_b
Simmer:Y105E8C.s:Screen_A
Simmer:Y105E8C.s:Screen_B
PCR_productsjj_Y105E8C.s
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8A.6 Source_evidenceePCR830WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8A.6 Source_evidenceePCR905WS150 Sequence/Annotation Release
Chunk_score Abs_score821
Max_abs_score821Y105E8A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1438117114383028
Overlaps_transcriptY105E8A.6 Source_evidenceePCR905WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y105E8C.s1858taaaatacgcttgctcgctttagagtgcctagctcaattttccacatagttcagatcagttaagagaactataacctttactattttaacacatagtttgcaagaattcaatgaattttgatggttttccccattatttcacacacatgaatctgaatttaagaaaatctttgattattattaggatttttttcataattcgtgtatattttgcaagataacagataaacacacatatatatcattactaaacaaaatgtgtagtgatttaaatgagtttctcaatggaagcttgatgatcatccggagcgtattgcaatccattatacaacttgtagaagcaatcatgacaatatggcttcagatcatgttctctgtaggttccatgcatgttgagtgccttctgacaatatgtgcacatgaaatgataggtatggaatttctgtgcccgttccgagtttggcgccaacgctgtcagaatcgcgccgtcgatttcttcactgcagtaagcgcagactgcggcggccggtggcggtggggagccggagatgtggagcgttcggcggggagttgtgcttcgggcgcggcggcggcgcaggctatcggtctcctcggacatttggactccgtattggcgggagtagtcgtctgtctccatattgtcgtcctctgctggaatttttcgaattctacattttttggtccaagttctgaaaactcacgaatctttggcctctgcgggatttgttcctctggtgccggtgtaagtctcaaggtgtactcgatttcctccttcttcttcttatttccatcttcaccgtcacgtccacgttgtccacgacgcaaaacttcagtcgtggcgttgacatcgtaaacaagggccgccaatgtgtcggtcaccgcgttttgtcctgaaaatggattcggtgaaagttaagaacagacctgaagctgggggaggaggtccagttgggccctaaagctattgttggaggtctaggtaaggtctgaattaggcttgaagcttagaaagggttagggagggtctatatgagatctgatgcttaggaagggcatagaggggcctgaagcttgatatggggcctagatgggatcaggggcttaggataggacttgaatgaggactgaagcataatacggagcctaggtaagatcgaaggttttggatagacctagctggaatctagagctcagaatatggtctagaggggcctgaagccaaggacaacgtctaaatgagtcaaaggctcagaatgggggagaagtggttctgatgcttaggatagggcatatgttggatctgatgcttaggaagggccttgacgggactgaagctaaaatggcttctgaagcttacatggggtctaggtggagtctgaggcctagcataggctttggataatgtctgaagcataatacggagtctaaatatgatcgaatgctatggatagacctagctggaatctagatgtgccctaaagcctagaaagaattatgtagcagattatagatgcgatctgaacctattaagggttctaacgagatcttactctgatcctgtttcagcttgacaagctgctgattcatgtcatccgagctaacagctttcaaccttgcggccagccaatcgtcggtcggatcaatcgagattctaccattgacttccatctcggtttggaattgacgacgttccattctctgaaacaaatttcaatgtattcccgcacaagatctgaaaaaatcgataccatctgttcttgtttgcgacgaatgatctcggtcgtctgctcgacatcgtttttcaacgcggtaagtgttccattaacgatctcgtctt