Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6D.6   

sjj_Y106G6D.6RNAiJA:Y106G6D.6
PCR_productsjj_Y106G6D.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6D.6 Source_evidenceePCR300WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6D.6 Source_evidenceePCR374WS150 Sequence/Annotation Release
Chunk_score Abs_score290
Max_abs_score290Y106G6D.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1011810410119254
Y106G6D.8 Source_evidenceePCR24WS150 Sequence/Annotation Release
Overlaps_transcript Y106G6D.6 Source_evidenceePCR374WS150 Sequence/Annotation Release
Y106G6D.8.1 Source_evidenceePCR24WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6D.61151ataaaatgggtttcaagggttgttcttatttctttccagcagatacaagtcctttcagaactgataatccacgatcgaatagagatccagaatcctgaaataaaacatatcttccaactagaattggaaatacaatattcgattttgataatttcacattacatcatcaattaaaaaaacatgatcttaccgtaacagctccaccattgcacaaatcatctgtattacaacagcaaaaagttagcaactgtccagaaacattttgctcgaaacatttatttgcgtgaaactgtaattttaagattaggcatttcaggtaggtttcagacaattttctacatttttttttgaattagatcccgttgaaaaaaactaattttcaaatgattgcttaacgttttggaagaacctattacccaggtgctcaattctacttcgtttcaataaaagtactgtaatatgtcctaccacgagcaaaatattttcagatcgacgtcgcgcaaaatcatgtgcacctttaagaattacagtaacccatttcgaatttttcctggttttccaggtatttttctctcgattatatattttttggttgagaaactaaattgaaactacaattcaatttaaaaaataatacatcgaaatctcggtgaccgatgataaaaactggaggggtgggttactgtacttttttaaaggtgcataaatacattctcgcgcagataaaattttaatatgtttcattcgtggcgagaccggatacggaaatttggctgaaaaatcaggaaatttcgcgattgggtgatatctattctaaaacatatcgagttatgaaaccggaagcctcaagtaagaagcctaagaaaccgaaatcaccttctaaaaattctgtaattttctttttcatgatttttctactttacctgacaaataactgtattacacccagctttttgaaatttgctgaaactggagatatcggcagttccattataacaaaagtcagtttctttaccacattcttttgtttcagtaccaattgtgcttcctaaactgtagtatattaaaaattacttccaaaattatatttattacctttcataattgaataacctgtatagcattttaaaacagcttgggatatggaaaat