Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6E.3   

sjj_Y106G6E.3RNAiJA:Y106G6E.3
PCR_productsjj_Y106G6E.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6E.3 Source_evidenceePCR654WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6E.3 Source_evidenceePCR654WS150 Sequence/Annotation Release
Chunk_score Abs_score570
Max_abs_score570Y106G6E.3
Specificity_index0.593
Rel_score1
Map_statusUnique_ePCRI1022037610221463
B0379.2 Chunk_score Abs_score392
Specificity_index0.407
Rel_score0.688
Overlaps_transcriptY106G6E.3 Source_evidenceePCR654WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6E.31088gatccaaattttccccagtttaccaacttaatctactgcgaagcctggcgcgcttgacgcgctagtcaggagagcttcttacaaattattgtaaaatgttttccaattgcaacgttcatccttttcgcggcattttgtgtaagtttatccatacaattcattgattgaaacttcatattttcaggcaagtaaaccaaaagaagttagaagaagcccagcgagaaaactgacaatgtcaacttctactttggaatctgaaaaggaggaattgaacagtgttgagatggttttggcggaagagatcaagaaggaggaaaaggaacctgaaaaaccattgattaatgagacaatgtcagaagatagaagtgttgcatgtggaaataaaagtgattcaaaggaactaaaagaaatggcatctccagataaggaaaagaaaaaagaagactcgaaagcagagcaagaattcgtcctcgatgaaaccaatccacattttgcttttcttcttgctggagaaaacagagatcctgctcaatcagttcttcacgcaaaaaatgcatttgaacactcgaatggattcatgtggacaatgaagaagagattggcttttgatgaaggttgctggaaacacttgagccgtagaattggagctattagagcagaggtatgtagagtatatgatatatgataatgttccacctttcaagctttccagggattcgaagtcagagtgaccactcgtcaagcaagggagaaaaagcaaaggtatgttgatcatgataacctttttgaaataataatatttgcagtgcggatcgggagaccaaaattgacctcgtgttcaacaagtttgagagtgaacaatgattactatgtattgactttaaatgaatatttttgttcagtttcgtgtagttgctcttcatgtaaattacagggcttctatcatatatcgatttaactacatcagtcctcatctcggtctatctgaactgtgtgatattagtgaaaccattgaatgtatctaatttttgctaattaatgtcttcaggcctttgaatcctttcgttttgtgtgagcaagttttcaga