Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6G.3   

sjj_Y106G6G.3RNAiJA:Y106G6G.3
PCR_productsjj_Y106G6G.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y106G6G.2 Source_evidenceePCR332WS150 Sequence/Annotation Release
Y106G6G.3 Source_evidenceePCR390WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6G.2 Source_evidenceePCR684WS150 Sequence/Annotation Release
Chunk_score Abs_score644
Max_abs_score644Y106G6G.2
Specificity_index0.693
Rel_score1
Map_statusBest_ePCRI1032348410324512
Y106G6G.3 Source_evidenceePCR390WS150 Sequence/Annotation Release
Chunk_score Abs_score285
Specificity_index0.307
Rel_score0.443
Map_statusTop50_percentile_ePCRI1032348410324512
Overlaps_transcript Y106G6G.2 Source_evidenceePCR684WS150 Sequence/Annotation Release
Y106G6G.3 Source_evidenceePCR390WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6G.31029aaaaagttcagcgtcaaaagttgattttaaatacgttattaaaaaatcgtattttatttattaccgactattgcgattgtcaagaagctcgattcaagatacttttcactttcttatcaaatgtcgaattcgaatccaagttcatcgccagacgtttcctcgcaaacatccgcgactcaggaggagccgaaggttaagccacgtcatttggagtcgcgcatcatgtatacggattatgatacacaatggcagaagaagatcaccaaatgggctcgtgtggcagttcagatggttttcgaaaaagttgttgagacggaaaacgagttttatcaggttagtgttatcattaccatcagttatcgaactaaggctttcatcataggcaggcgtttcctcacgcctacctgcatagcagtttataccacatctccaatttttgatctccattatttcaggaagttgcggcaagtttcaaagagtcactcaaatcttcttctggagacgaaaaaccgaaaaaatggcatgtgatcgttggaaatgatttctcagttcaagcggacgctctcaagggcaccatctcgttttttgcaattggagatgttaaattcttaatctacacatcgcctaattgaaatataaagttttgtatcaaacctcttccttatcctcctccttatcttcggtttttcgtcgcaaaaactttaatcgtgaaggtttttcatagcacagagcaccataaatgtacttctccagctcccatacgtactcggagcatcttaaaatagaaattgaaggtgataagcggattgtttagatacctaacaatatacttccagcacgaagaagcatgaattgcaattctagcttcatcaagtaccaattgcattgctaacaaatgctcccgggaagtgcacgtggatttttgttcattatcacctgcaatcgcatcatctcgaagatcttctaagcagcatgaagtctctacaagttgctcgaatatccaaccacatcgagattcaagacctgaaa