Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6G.4   

sjj_Y106G6G.4RNAiJA:Y106G6G.4
PCR_productsjj_Y106G6G.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6G.4 Source_evidenceePCR858WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6G.4 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score816
Max_abs_score816Y106G6G.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1032186310323388
Overlaps_transcriptY106G6G.4 Source_evidenceePCR858WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6G.41526agttgaattggcaacaatagcatcagtgacagcaacagtgacaacagattgggatgaactttcagcgagcgtagaagtttgaagcgtagtattcaagacaggaacagttgagctattgatgggaataactgaagttacagattccacagttgaatttgatgagtttgtagttggaggaggatctgtggaggtaatggtgaatccgatagtagtgacaatcacagggatcttcgttgttcctgtcaaattggcagatgtaacgtgcgttgtgccgttctctttcacatctgtagaactggtagagcggttcagcggaggcctcaaagtggaaataatctgagtggagttagtagctggaggtgctgtcgtggtgttggtcgtgttagatcctccagtcaaggcatcactcctggaaatgtcaaattaaacagggattttgatacattagaattttactccaaaaatttgaaataacagcgaagacaaatggaagtaaatcgagaaagaacgagaaccccaactcttgaaaatctttctatttgaactccctctgaaacgagaactgcaaaaccaatcagcgatctgctcgtttgaacccgtccactccgttaattggttcagaagtaggagaagcgaatcgccggctggagggagttcaaaaaggtagattaaccagtgttggatattgtattatttttcgatatttgttcagtttgttcttgtggaacagaacatcttaaaatatcatcatcaaagtgaatattgcatcattaaaattgtctggagcggagcgctcaaatatttgctcttaactcggatgaacgccgaaatcaacgcttcactggatttaaatttaatgatgcaatttttctgccttgataatgcactttaattacaaagaatattctttgtttgctcagtttacatactttgtatcctcttccgccaagaattcattcaaaagcaacattgctccaagaccaagaatgcagatgacagcaaggaagatcgtgacagctgcaaaacaacaccaacaagttccaaactttgaattcttccttttgtacttctttttattttttgcgccattattctgcacgtgttcatcactttccgaagaccgcgatattggaaccaccgattgttcagatctcttcggattgacaccatccgaaaagctcaaattgttgagatccatacgtggaggtcgatttgactccaagtcaacgtcatcattagccttcagtgctggagtggcatcaagaccactgagaagatccggatgagcattctttggtggacgaggagctactggcgtttggggtggaggtggaggcatctgactatcattgccgagatattcgtagtcgttgctcatttttctgaaatttaagcggctgaaaaacatgcagagaagattcaaaaatttaccttggttagttggttagtcgtcggaaacaagtagggaatgacaggatatctgaaaggtgaaaggggattataaaaggtgaaaggggttatggtaa