Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6H.1   

sjj_Y106G6H.1RNAiJA:Y106G6H.1
PCR_productsjj_Y106G6H.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6H.1 Source_evidenceePCR791WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6H.1 Source_evidenceePCR791WS150 Sequence/Annotation Release
Chunk_score Abs_score728
Max_abs_score728Y106G6H.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1043027610431874
Overlaps_transcriptY106G6H.1 Source_evidenceePCR791WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6H.11599cttcaagatctcatcaaaatccgagatgatcagccaccatgtccacaaccaaatgcaacaatgttcacaacacctactacgccggctgcacccacaacgactgctgatccaactacagttgcagatgacacaactacagctggagcaaccgattcgagcacatctggagcatcggatgcaccatcatcaacaccaccacctccaccgaaaatttctgacaagaagaaaagattcagtccaagtaaagtatatgtgacaaagacaaaggatatggatcctttctcctggtatatgaagactcttcatgtaagctgaaattatgacttaggaggcttaggcttaggctttttcctatgtttcgacttaggcttagacttacgtgttggcatggagaattgcatcgtgcctacgaacgcgtgtctcacgcctacctgccctgtctcttctccgatactccttcacaggctgtatatatatgtctatttttcagtactacatgaaacgtgaatcagaagtttgtaataatcaaatcaccgatcttaactccatcaccgaagatcaacttttcggatacttctccacacttgctactgctcatccaggaccattctgttcactttgtcatagatttgccgaagaaattcattcaaaagtattgaaaccaaatagccttctgattactgatgatgaataccatatttcacatcttctctacaatcattttccaaagccaaaagcaatttgtacagctattgcgccgggatgtgatgacgattatgcagcgaggggtaagagaaatccgatagaaattgaaactatttttcgattttttattcagtttttgaaattatttttctagaaaaaaattattgaaaaaaaaaattataaacttcacgaagaagatccttcatgaaaaattcagcagatgttctaaaattttaacttttttctaattaaaacgtttaaaactagatttcagattttttttaaacccaaagttcgaaaaatctcccaaaaaatattaaaatcatatatttggaaattaaagtttaaaacaaaaatgtgttttgcatcaatcacatttttccagtgttatgctttcgaaacatcactttaaaaatacattattacacagttgttgtgaagtttaccgatgttccattcaaaaatttggtctcaccacgaagacttcacatttttcagaattttgtacgatttagcacgttttcagagaatttcctgatttaacaagagaaaaaacgtttaaaaaaatcgaaataattttcgaattgagttactgtagaataaaggcgcacacctacagtcttgattcgagaatattttgttcgtggcgagagtttttaagcagaaccacaaaaaatttcgcaacgtggaataattttcaatttcagttctaaacctgaccgaatcagtagtctgcctggaatgtaccgcctgtatgtccatcacaaatgtgcttcaacataagatcttccttcaaccagccatgcttgatcagacttactattggctccgcggaaaccttttccacaatttgtgtgctgaactttgtctcgcattccagggattagatattcc