Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y106G6H.7   

sjj_Y106G6H.7 RNAi JA:Y106G6H.7
Simmer:Y106G6H.7:Screen_A
Simmer:Y106G6H.7:Screen_B
PCR_productsjj_Y106G6H.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY106G6H.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
Overlaps_Gene Y106G6H.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
Chunk_score Abs_score674
Max_abs_score674Y106G6H.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1044898210450175
Overlaps_transcriptY106G6H.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y106G6H.71194acatgcggaatttggagttctcgttgaaaaacaactcggaagaaaagatgttgtcacctcgttttggagatccgctcagtctgcaattgaggtttattcagaagagaaattcaactaaatgaacctctagttttcaggttgttgtatcagaacatcttgacattaaccctctacttgaaaaacaaaatgtactgggaactgcaagcagaaaacaattattccgctttgaaaatactgcctgtgcgactccaaatgccaactcttccagtcatcgggtatttatattactgtatgaatataagcattttaatgtttctttttccagacaaaagctgtaatttgcaagccatctgcttacaatattaaagtaatcttcccaattctgagtcgacttatggaaacaactgaaaagaatataaatgattcaccgtgtgaattacgaagatttatgcattcatttgtgatggaagtatttgttgaacgagttaaaggagaacttgcttctcgtattgaaggagcattgagaggaggagaagctgtcagagtttctactaataaagtacgagaagaaattgaatatctgataatcaaggcatattttaatttcagaagattcttccttcttgtgaaaaagtactcaatttgtgtaaagaagttcaagatttaattgtttctatcgatctctatgctgatcgatttgcagcactttggcttctcgttttaacggattatttcaagaatatgactgatgtttacgatagagtacggttttatattgcgctaaaaattttgaaaaaagtgatttttaaattgtaacaaataggtattttgaattttaggtaaaatttcaaaactggctagaaatttataagaattcaatttttctatgaaatttctattaaaaaaatcaataataaaaatgagttttctaaaagaaatttcaaaagtttttctaaattttgtaaaaatttcgataaaaaatcaataaaagatatgtatatttttttgatacaacgaaattacttttccagatgactccaaagaatccagatccttctcttccaaattcagaagctcttccaactcgacgacagaaaatatcagcagcatggactgcagatgatgatatatcgcgtctcttgatgagtcttccgaactggcatgctgcttcaatttctccaatgacaccagcag