Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y110A7A.D_b   

sjj_Y110A7A.D_bSequenceCCGAACAATTGAAGATGAGATTC
PCR_productsjj_Y110A7A.d