Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y110A7A.D_f   

sjj_Y110A7A.D_fSequenceATTGGTCAGTGCAGTCAGATTTT
PCR_productsjj_Y110A7A.d