Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y110A7A.a   

sjj_Y110A7A.a RNAi (3)
PCR_productsjj_Y110A7A.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y110A7A.19 Source_evidenceePCR1996WS150 Sequence/Annotation Release
Chunk_score Abs_score1891
Max_abs_score1891Y110A7A.19
Specificity_index0.821
Rel_score1
Map_statusUnique_ePCRI51626285164812
AC8.6 Chunk_score Abs_score306
Specificity_index0.133
Rel_score0.162
Y108F1.3 Chunk_score Abs_score107
Specificity_index0.046
Rel_score0.057
Overlaps_transcript Y110A7A.19.1 Source_evidenceePCR1996WS150 Sequence/Annotation Release
Y110A7A.19.2 Source_evidenceePCR1923WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y110A7A.a2185ggagacattttgaaagcaaaacaaaacaaaaacaaaataactttacaactatcctaggctaaacgaaataaaattattgtgggcgaagacgaatgaatccttgaataattcgaacttgctcttgattcacattacatttctcgaaaatgcgattggcgagaggctcaagttttgcacggttggcggtcaacgacataatttgcaggcaagtcgctgcagcatatgtatcacgttttctaagagcatcttcgaacaattctgccattgcccatggcctagcatgtccacgtggataaacagtcgcttcgtccccactgcttgcagtttcatcaagcagtagatctaacagttcgtaagctttctgctgttctccgattctggtcaagagcaaagcacattctgagatctgcaaaatttgagaaatatacgacttatggtttgaaaaataatattaaaacctggctaggcgacagtttcctttggagccttctcattctctcttctgtgaattggctgaactcaacccaaactgcaaccaatttttggacaagagatgtgaattgctcccgttcactagttcccaatgtctgaaaaaaacttgtaaaaaacacaagatatttggaaataaaacttacatgtagttgtacattacacaactgtttgcgcatttcttctccaataactccattcatctgtccagctgcaataccgtcgatgattactctccgtaacagtggccaatgacgatcggaggatgcagcgagttttcgaaaaactagtgatgacagataattgttgactccaacaagtcgtggtaccatggtggtgtacaaatcataaattctgttcagtgaagcactttgttccacagccaattgtaattgtctattatagaacattgattcaattgtgaatgctggcatctttacttcgtttgctttggattcataaattgaaacaagattttctgcgaggttctcatttgcagctctgtaatggattcccattgcttcgacgaagaaaagattacaagtggatgtaatcggcttgagagtttttccagtaaggctattctgaatttcattgagccaagatatagccacggtgagctggtgattataggtcttcttttgctcgtcactctctcgtttttcattatccaataatttaaaatctatgatgtttttgataattaaatgaaaagatgacagtgctggttcaactccaatctctttcatttctccaataatttcagtgaacgccttcacacgatcttcaaactttccagcttttgcagcagacgacagtaatgcattgaacgtgaaaatatcgggtgtcattctgagggaaatcatttcagctaccaatttcttcccgacactgtagcttgaagcgccaattaatccattgaacgcttctcggtaaacttttccttttgcagctcgatgctccttgtacaattctctagctctttccaaactagaatgatcagaaaacttgcatagaccagcaatcattatagaaacggtttcatcagtttttgggagagtttcgaaaagaagatcagcgactgcacccgatttccatgaggatgtagaatcttctccaaaattgcgcattccaacaaactcctcccattctgcgaaaggtacgtttgacgaattgtaataggttacaagacggaatagttccagctggactttctcgctaacgtcaacgttctctgatcgcatgcgttcatacaaaatacacgagtcttttacttctcgacttgaaatcattttaagcaggttattctctgtcggttcaacttgaaggggatctgctagatgtcgaggacggaaaaccgggagctgaggttgatctctgtcaaaagcgaagagggttggccattctgtagctagttctcgtgcagctcttttgccaaactcctaaaattatcaaacttattctaatattccggcaaaaattttaccttcgccataaaataggtctttttcgttgactgcgtggaaggaatggtaattggatcgtcaatgtaggcaaaatgtggagcagttgtgtccgggccaacggtttctgacaaggcatttaacaaatctgttggagatctctggaaatatagaagttcaagtatgaatttttaaaaatagtcaacctcgattgctggctgtattgtcaattt