Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y110A7A.d   

sjj_Y110A7A.d RNAi JA:Y110A7A.d
Simmer:Y110A7A.d:Screen_A
Simmer:Y110A7A.d:Screen_B
PCR_productsjj_Y110A7A.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY110A7A.17a Source_evidenceePCR1876WS150 Sequence/Annotation Release
Overlaps_Gene Y110A7A.17 Source_evidenceePCR1876WS150 Sequence/Annotation Release
Chunk_score Abs_score1666
Max_abs_score1666Y110A7A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51246595127113
Overlaps_transcript Y110A7A.17b.2 Source_evidenceePCR745WS150 Sequence/Annotation Release
Y110A7A.17a Source_evidenceePCR1876WS150 Sequence/Annotation Release
Y110A7A.17b.1 Source_evidenceePCR940WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y110A7A.d2455attggtcagtgcagtcagattttgctctttctttaggtgaaccaacccgagaccataccaggcacggtaatcgcgaggagaaaggagaagtgctgatctgaaaatttaatgttttaattaaaaactttcatgatcctataaatacctgaaagatcccgcagctttgtcaagttcatcctgaacgataagctcatgccccaataaagtgtatgcgtaggcgaatcgtttgtcaagttgaatagccctctccatacattcaattgcctgagtatgctgtctttgtaatgagaagcaatttccagcggcacaccaactctgtggccgttcccgtgattcagttgtcaaaatctgagaaagagccgaaagagcatgagtatcttgaaggtgccacattgaggtggacaatagctcggttccgtcaaccttccactttctacgtttatgcaaatcatcgagaatgttccggcactctctgtattcggattgctcgaagcaagctcttcccaactgaagacggaccatagacgtgttaagaatgatatctctatcgagttttgcgaataaagcatcagccgatctccaattgtatgtactgattgactcttcaataagtgcaatgtgttgataaacatcaaataatttctctgaagaacaaataaaatcattaatttttgattaactgatttcatactgtattctggatcgtaaactccatcgacaatatccataggttcatcattgttcaaagaagaagccacagaagggagaggaggattgatctgggatacctcatcttctgatggacgctcactagctgttgatgccacctgaagctgctaataattgaagaaaaataactggtcattatattcttacagaattggtagaacccgacaaactccgtgcaagatttgagtttctggataccaaaggttgtttttcatttcgtcttctttgactcagagttttggcagtcttgtttgcagcagcggcggcgtcagcaattctgattgaagtacgcacaggattggtctaaatttagaaaattattaatttcagtgtccaaataaatgttaccctctgggacgacgatgaccctctggtaactgatgcaattccactccgagttctcgtattcgatgcattcgaattctccgtatcgctgtttagtgcagcactgaaattattgaaataaaatttcaaaatctgtcaccactcactttgcgcgatttctagagctatgtgtagccctcgtgtgtggtctctcgggttctgtgaataacgatgatcgagatccagtgactgaagattcggtacgtcgtgtcgtcatttcactgattctggagctttttctcggggcagttggattaatacgtgaaggtgtggatccaggagtggattgtcttggagtgatgtttgatgtggtatctgtaacttttaatttctgattcagcatgatctttcaaaaatttttaatagtggattttgaaaaatcgcatttttagagtcggatttttttctaaactgatattccaaaattttattctccaaaaaagaaaatcctataaatacttcctataaatttacggaaaatttttcaatagttttttccgcttcactcacttcttgtctcgcgattcgccgaagcaatcgtaccgcgtgtagatcgtctgaccgaactttccagtctggaaggttcagcagtgctggcagctgaagaagacgacggcccaggaacatttggtgatggtgtttcggatttcaaactcgaagctggactatccaggtatagaccatttctataaaaatgtcggcataatatttaaatttaaacattctcagaatcttacgattttcggtgatgtttttcaaaagtatgggcgagatcatgacctccaaaccgtaaataagttatgatagctgaccacaacaaaatattctcatccagagacttttgacaagattctaaagccagatccatgtaactttcatcgcaaagcatttgagcatgaagcaaattagcatgtgatgcaacccgtggctcttccaggatatctttccgtatcactccatcgtcatgttcgaaaagagctcctctacagtcatcgattctaaagaaaaattaaaataatgaataaatatacatatatattacaaactaacttatttaaatcgtaggatacccttgcaagtagatagaagagtctagctccgctcaatttaactgaactaaggagaccataacattcctctttcttattggctctatacagacaatcagcgtatagaagaagagattcggagttgttgcctgaaaaaaagttattgaaattaaaatatgaattaaaaacgaaaaccacttttatcggtttcgtaatgaagctcggctagaaaaatagcatcatcaaaagcgtaacacttcatcatttcatgaatctcatcttcaattgttcgg