Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y110A7A.o   

sjj_Y110A7A.oRNAiJA:Y110A7A.o
PCR_productsjj_Y110A7A.o
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y110A7A.6 Source_evidenceePCR1474WS150 Sequence/Annotation Release
Chunk_score Abs_score1348
Max_abs_score1348Y110A7A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI51317085134153
Overlaps_transcript (6)
WB_DNA_textsjj_Y110A7A.o2446attaaaattgatttccgtccgtttcgacatggaaaatttggcaaaattgaagattttagctaaaatcaaatagcccattttttttcgaaattttgagccgttttggacgcattttgagttgaaaaagtgcataaaattgatcgattagccctattttattttcattccacattgtcttctcaaaaatctcaattttcagacaactcaaacgagcaggttcgagttccaaacgtcatcgcacttgtcggactgccggcacgtggcaaaacatacatctcacacaaactgtgtcgttacctcaactggattggaattaagaccaaaggttggtcctgattcgattatatgtacgacatgaaacaaaaaatcaaaattacagcattcaatgtcggcgagtacagaagaagagcgtgtaatttggaagaagaaggcgaaaatgagttcttctcgccaaacaacgccagaggtcaaaagatccgagagtgagattttacgaaactatgaagaaaaaaaattaaaaaaattcctgaattttcagtgagtgcgcgaaattagccattgaagatatgggaaggtacttggataacaaggaaggagaagtggcggtgagttacaaaggaaaaaatttcaaaaaaatatatagacataaactttttattcagattctcgacgcgacaaatactacaagagaccgacgaaagcttctgatggagttttgcagaaatatgatgcacgagccaccattccgtgtcttctttgtggaatctgtttgtgatgatcctgatattatcaactcgaatatcacggtaacctttagatcttcaaaataatcaccttaacccgcatattttcaggaagtgaaaatcaattcgccagattataaaggaataatgtctcaagaggaagcaaaagaagactttttgaagcgtatcgagaactatcgaatgcaatatgagccacttgatgaggatcatgatgaagagctgagctatatcaaagttatcaatgccggaaaatccttctatgttcacaatgttaatggtcatgtgcagagtcgtgttgtgtatttcctgatgaatattcatcttcttccaagaagtatttatttgtcaagagtaagtttaacaaaaaaaccgaaaaaattttgcgctaaaaataggtaacaggtctcgacgcgaaaatttttattaaatgccaaaaagtgtgcgtctttacaaactactgtagtttcattttttttgctgccgagttttcattgagtttcagttttctcacgatttgctgtaaaaacgtttttattttttatttcactttttgataaattaatatttttttaccaaacaagctaagagagcccgtaaaaaaacttgaattttaacaaatcgtgaaaaaaaaagaaaatcaatgaaaattccgcagcaacgagagtttgaaattacagtattctttaaaggtgatgccttttttcatttaacaaaaatgtcgtgtcaagaccggacaccggtttttttggcacaaaattccgtttctgggatataattcattcaattaacagcactgagaattatcaagtatttttaaacttttatagtttaaaaatccctttaaaaaatttattacagcatggagaaagtgagtacaacagaattggtcgtcttggtggtgattccccactcagtgaaaatggtttaaattacgctggaaaacttcgcgaatacttcgaaaaagaagatttggacgatttccgtgtttggtcatctcaaaagattcgtgccgcccagacagcttctcatctgaaagatctcgctggtcatacagagttctggaaatgtcttgatgaaatcgatgccggaatatgtgaaggattaacttatgaagatttcgaggctcgttatccgaaacaattcgctgaaagagataaggataaatatcactaccgttatccaagtggggaatcatatgaagatctggttgctcgtctggagccagttatcatggagcttgagagacaatccaatgtccttgtcatttctcatcaagcagttctccgttgcattcttgcctattttactaacaaaaatcgagatgatcttccatatctgaaggttccattgcatacagtcatcaagctcacaccaaaagcctattcctgtgagattgaacttttcaaattcgacatcgaagcagtcaatacttacagagagaagccacaataggaagtatttattctttatctagccaattatctatgccaaatgtacatttattttttcatacaagttcccatttttatgtcgggcgttttttttgagattgcattttccctgtttttgaacaattgcctttgaatttaaatacgttgtcgtttatgtgagagttataaagattacatcgatttcaattttatggactgattgcaatatttctcgctgtgtcattttctaca