Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y116F11A.f   

sjj_Y116F11A.fRNAiJA:Y116F11A.f
PCR_productsjj_Y116F11A.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC43D7.8 Source_evidenceePCR315WS150 Sequence/Annotation Release
Overlaps_Gene C43D7.8 Source_evidenceePCR386WS150 Sequence/Annotation Release
Chunk_score Abs_score323
Max_abs_score323C43D7.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1931224419313767
Overlaps_transcriptC43D7.8 Source_evidenceePCR386WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y116F11A.f1524ggcgatggtagtcatcaaagtaggagagaattaataatgaatggtgcaagaccgaatgcacagtagggaggcattatcgattttcttctacatggcgagcgggaagtgacctcacagctgtcgtaatggaagaatacatgtagacgtcactgtggacgcagcgagcgattttgtctgaccgttttttaaatatttaattgtaagcattccaatttcgataaaattacatctgaagttgttcctagtagtcccagtgtttctcaaacgtacgcttctacaaacttgttttttttttcaaagtcaaaattcatggggcttcctgggatggttttttttaagtgatcaaaagcttacatctcgtgcttggcttcaaatttactaacacactggaaatatacatgaaatcatttataacaggaatcttatcagaaaaaagatcaagaacaaattatttccaaacgtacatactcaaacgaatgccttcaatgacgacagtggcccgtgttccaacaaatctgtagatgtctacagcaaacttgatatccggaaaacgcatcggcagtgtttccaaatccgatacgcttgtcacctccagcttcacacccttgaacacttcatccaaattgtcgatatcagctccaacaggaaatacaacagattcaagtggctggaatgctcccttgatccaatgctttaggaataaattcacttccattgtactcataaggggcatcacttttaagtgtacacagtttacacttagaagatcagttaaaccagcgacaacggtcaaattctggcggtgtgaactcaacattgggcggtaccatttgaaatttggcatagtgatctcaagggagagcctggaaaattgattggcaagctggtggagccaaacattttgagaatcacgttgtagactggtcttaggaatatccaagccgtcaagagcttcataaattaatttccaatcgtgatcatcacgtcaaacaaagaaatactcaaatttatttgtatggagaacactctggaaatgatctagcaatgttctcagatcaacttccacggggttccaaggaatatcctgttgataattttctacactgcaataaatactctgtgaacttgttgcaatatggtttaactcacaaattggcatgaaccgatatatgaaccgattcaccaaagcaaatccaaaacgggtcagcctgaagattcaacgattctgctgtcctttttgtagattcggagatcagagaaaacttgattctaaaatataacagtttgtcattggaaacttcggaaaatcttacatttgttccatagtcagacagcgaatcgcaatcttgagagacttttcaggcagcctgagaattggaaaagtcgtcatcgtggcaggaaagaaaggtaataatgaatgggactagacgcatatgcgcacagtagcatatgatcgattttttacatgacaggagacctgtccagctgtggatatgttaaagggtagcagatggtacgatactg