Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y116F11A.qq   

sjj_Y116F11A.qqRNAiJA:Y116F11A.qq
PCR_productsjj_Y116F11A.qq
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0399.2 Source_evidenceePCR1229WS150 Sequence/Annotation Release
Overlaps_Gene B0399.2 Source_evidenceePCR1229WS150 Sequence/Annotation Release
Chunk_score Abs_score1085
Max_abs_score1085B0399.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1955493219557246
Overlaps_transcriptB0399.2 Source_evidenceePCR1229WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y116F11A.qq2315cggttgaggagtaaataaaaaactatgaccacaaactataaactacaaactacgaaaaattgtggattatcctaacaagatcctttttgagtcactgtcagctccaacctcaaagttcaatttttttcaaatgatctactaacaaccgcaaattttcgctgacctctcataaaaccgcaaatacttattcatcatcgccacaacctcatccgtctcaatatcccatataggttgtttcaacgacggagaatatctggctataacaaacagaacatccggtttccgaagttccacctgctccttggcaattttcagggatagttgctcccaatatccagccggtgttgagaaattcccgttgtggaagaacccgttacagcctgaaaaaaattgaaaagaggcttgcacgtggttacgtagatctacaaaaaatgcgggagaagagacgcagagttcgcaacttatttcgcatggttaagcacgtgttgacgtcacattttttggataaaaaaatcccgcaatttttgtagatcaaaccgtgatgggtcccgcctacctccaataaaaagcgatgtccaatccgaatagtttgagcgaaattgtgctcgaatatgtccgtccaaattttccacgtagctatttccaacgagcattactgatagagtaccattagctttctgttaacaagaaatctagtttgtagtttttatagtttgtagtcctaccggatatctgcaatagtcaaatttaaacccattcttcctcagctcgggaagctcagtctccagacaagtttcctgtctgggctcatacgacgtaatatagggaagaagcttcatattctcgtcgacaatttttcgaactcttggctgatatttaggtttccagaattcgtgggttctagtgctccattgagctgctccgtttaggcaaatgagcagtaggatcagaagagccgtcggttttgtgccaagcttcaggtactgtttctcgtaaaggtgatgagccactacagaaatcagaagtgtcagtgctgaaaaatttgaaaattggggaaagtgtagtttgtagtttgtagtttgtagttttaagctttttcgcacagtttctcaatattcagcaaaagttcaaaatgagaattgatagtgctaaaaaagaggtgtgtattttgtagtatgcatttcatattttgtagtatgtagtttgtagtttgtagtttgtagtttgtagtttgttttttatagttttttcactttctcacacagtttttggataatctgcaaaagttcaaaatgagaatggtcagtgctaagaaaaaggtgtgtattatgcatttcatgtttggtaatttgtagtttgtagtttgtaatttgtagtttgtagtttgtagtttgtagtatgtagtttgtagtttgaagttttgtcaaatgttttgttttcaacattgaaacttgaagttactgtattctatttttccagattctagatttcgattttagcaattgtagtttgtagtttccaatttgttgtttgtagtttgtagccttaccaatacacactgcatgactctgaatagttgattccttgaaaattgcaataaccggccagtgaaccaaatacatgacatacgaaatatctcccaaatagcacaaaattgagcttttcagggtctgaaaattaccaattttctggaaaaaattcaaaattggcttgacatcttaccccgcaagtcttgttctccaagaaaatcaccgcagaagctgaaaatgttacaagtgggcggagccaaacagcatctgcctccgctgggaaaatacacagaaatagcacggcaaccaggcaatatgcaacatcattttggggaattttccacgtttctggtttagaatctttcacaggttccgtaggtgcacattttttcagaaaaagtgccacaaatccggcggaaaattgccataaccttagcagcatgtaattgaaggcaaaatttgaattgctgagtaaaaatcccaacattccgaaaatcgagatcccggagactagtgccagcttgccacgtggactattaggcagtccaatttgtaagcctataaagattacagggacaagcaggtagaattgcatctcaacgcccagggaccaagtatggatgaaagtgttgatggaggtgccgtcggcgaggtactgaaaatgaaaaattatgctaagtctatgcatttttgaatttagaacattaaaacaaaaatttttggacctcgcgggggtcgaacccgtgaccttctgggcgcaaagaaaatcatggaaaatcccactgc