Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y119C1a.a   

sjj_Y119C1a.aRNAiJA:Y119C1a.a
PCR_productsjj_Y119C1a.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C44E4.3 Source_evidenceePCR177WS150 Sequence/Annotation Release
Y119C1A.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
Overlaps_Gene C44E4.3 Source_evidenceePCR187WS150 Sequence/Annotation Release
Chunk_score Abs_score166
Specificity_index0.195
Rel_score0.242
Map_statusBottom50_percentile_ePCRI46406974643195
Y119C1A.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
Chunk_score Abs_score687
Max_abs_score687Y119C1A.1
Specificity_index0.805
Rel_score1
Map_statusBest_ePCRI46406974643195
Overlaps_transcript C44E4.3 Source_evidenceePCR187WS150 Sequence/Annotation Release
Y119C1A.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y119C1a.a2499atcacgatatgctccaactcctaaattaatcttattcggattcgtatccttcttgaatgcttcagtaactcctagaattggatcagcaggcgctagcggcacatttctgaaccacgggagcactggttgagcagttacagtagtcgttgacatgaaccttctgaagaatgccagcattttctgtgtgctgacaattttaatttaaaatcaatagaaaatggaaacaaaatgatagatattagaatatgaagctgccacggagcttacaaggaagtcgtgaaaaaaatcagaaaaaataaataaaattcaaaaatcgaggatttcattgaaaaataagaaaagtttgaacacaaaatcaagaaaaatcaagaaaaaatatatatacaataaaaacacaaccttcggttaaaaactattattacattagaacatgattcgatattgacctttgcatttttttaaggttacaggcggaataatgggtttttttgtaaaatttgacagaatatagtctgaagacacagaatataacggtaaaaaatttatagaattttcctaaatttattatgattttttttcaatttttccaaaaaatttttggatttttttaaaacagttataattgtaattgttagacttttcctgtcattttagagcgaaaaaatccgaatttccgaagcaaaatgactgttcgatcaatatcgaagctgtttaggcagtggaattagctgtggaacaatactcacaaccacaaaaatcaatttccgatggatcaaatcgacgactggggagctgacaatgatgacagcgatacgaattggagttattctctctggaacaacgatcacaaatccatggacccgtactgttctcctgactgattgaacgaggtggtggcggtcctgaaacaggaattggaaatttaggtcgattgctagacaatggtatttcggagattttacaaaaagattggcagcaggcgacaattttttttggaaattctaaaaatggcctatcacgtttttcattgaaaattggtgtgaaaatatagaaaatcacttaatttatcagaaaataataatcttttcaactgaaatattggagaaagtgctcgggattggcaactttcaggtagtttttgagcactttctccaatatttcagttgaaaagatttttattttctggtaaatcaagtgattttttatattttgagactatttttcaatgaaaaatgttgaaagaacatggtgcaaaagaacataggtcatttcgtagaattcccaaaaaataatgagctttcatccatgattagcactcacttggaggtggaactccttttgcactttttgctctcaacctttttaatttttcttccaattttcgaacagttctctccaattcttcttcattcgtcgcggcatcgttaaccagtgtatgtggatattttgcatcaaaccattttttgagctcagtgacgtcatttgtgattagatttagtgatgtcacctcgttgattacccgttgttttccttgctccagtttagccgattgagctgaaaaaaataaattgagaacagatttgtcgtttttttagttttcggctttgctcccaaaaaatacccaaacacacggacgaaatgaattacgaaacattttatacactatttttttttcgattttttctcataaaacttgatggaagaatctacgaaaaaaaactatattcgtgtcgagaccaggtcctgagaatcatttttatatttctacctttccggagctcaataatttcatgttgatctggtatcaaatagtctctttcatcgtgattatcatcgtgatgaacggctaaatgatcgaatccactaccagccgtctcatttccagatccagtatcaaggcttagaggagcaaatgatggagtttgtgaagctgaagatgatgaggcagtagatgatggatacggaggtagagctgctgcatttagagcccaaccatatggtggatctgcaaaaattatattatttatatacaataaaagaggataatcgtttgtttatggttgaaaagaagaagaagacaagtttatctagattatcctttgttgttttttatattatttagagaaacgggaaattcaaaagagcagttgacagtatattcagtcatctgcattttttctgatagactctaaataatttacaaaatagctgttagaaagtgaatttgtatttataaaaaggttgctggatcttcgaaaatgcttgaatttgatttttgtaagctttccgaagggattcggttttttatgaaaaaaaatcaattctcacttggtatttgctgctgatgttgtggatatgagaactgtggaaacccggttccaaatccaggatgaaccggaggatacggaggattcagaagcactggttgatgaggcatttgtggatcggtagtactacttgaactagtactttgagcagaattggtctgttgagcagaag