Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y119D3_462.a   

sjj_Y119D3_462.aRNAiJA:Y119D3_462.a
PCR_productsjj_Y119D3_462.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY119D3A.4 Source_evidenceePCR1026WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptY119D3A.4 Source_evidenceePCR1026WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y119D3_462.a2462accagtccactaaaacaagcaaaattttttgaagcactcatttacattgtcagctgtcatgtgctcaattttcatcaatcatacgatttctcagctcaaaatcaatatatcctattttacaacattttccagaaatcattgtggatgtttcatacacagaaaaatataaaaatgacaaccgaaaataatacgaaacaaaattagttagcatcttttgattcttaactgccacatgttcataaattcgtaaattccataataaatttcaaatttggatttcccggttgaatactccatggtgaattcatcgcaaccagcatagtccggttgaaatattcttgcaagttcagggttaaaatttacgtttataaccgaaattacgcatttccggaacgtacttctttgcagcaaatcctgaacatttgtttggttatagaacttattatcaaagttattgttaaagtttatagttacttacagttaaagagttacttacatctcgaattttaatcacactttgtattggaatatcatgattcttgacaatatcaatacgaaacttctcaaaatggaagaaatattcgataggcaaacattcccacgaggtttcccataacttgaattttttcgcctttttccactgatccaaatgagttattctctcaaagtcatgagctggaaagattcctcttatccaaagttttctcaatgtttgactattgaataacggaaggattaatacaatatcgtcgattgataagtcacgatgcaaagatatcgttttcatgtggatatccacttcctttttcaagacgtcaactagagaattgacagcgtgttctctatcttggtcattcaaataggatataatatatagacaagatgcatgcttcagaagtatcttcaagtcattgaaagccaacttcaaacagttttctccctctaaatatttccattcattattgcaccacacagatgatccactaagaagtgaacaattacggtagataatttcaattcggtcgagttgtatcctaacgctgtcttcatccaagacaactgagagatcggtaaattgagctccgaagttatcaacagcggtccgtaaacttcgacaaacttttcggcaggtccacctggaacaaattatttctaattttttttcattttcatttttccattttccttactgaacctgctctgaagcagttaaatgcataggaggaatcaatgacacaataaatttaacatagtactaagtttgtacgttagtcttaaatactcacaattcattgagttttagcttctcaagaacgtgattcgcaactgctataggcagatcgagcagagttggctgtttagcagacatgtttgaaagtttatctgaaagtttagaaatgaaaatcgaagtagtgtaagattaatatgtgttattgattcaaattgtttcaaaatgaaaatgataatagacactgaattaatacagaatcaaagatgtgaatagcaaaagatgagaacgttgtttgtttttttatatcaggttgtcccataagttttcgtactatttttttttgaaaaaaatttatttctctcaagcgacaagtaatactattcacacaagtattcaccattagtgttcaccacttgttgccatttactaggtaacatcatgatgccacgggagaagaaatccggcgaacgcgatgagaagaaagtggagagttcagttttgagatgctcttcgtcgtcgaattgcttgtcgcgcatgtagtcactgagagacaagaacaaatggtagtcggttggtgcaagatctggagaatatggtggatgcggtaaaacagtccaaccaagatcttgcagcttttggaaagtcttcttggcgacatgaggcctagcattatcgtgaagaaaatatagtttttcatattttccgttggtcttttctgcaactcggtccaattgggcacaatagtaatcagcagtgatagttttattagttggcaacaattcccagtgcacgggtccttgaacaccccaccagacacagatcataatcttttttgggtgaagatcaggctttggcgtcggtattcctttctcaccgatcggaagccattgacgttttctggaatggttaacatagagcacccacttctcatctccagtaaccagattgttcagccaatcgaactttcgacgaaaagttagaagttgagtacaaacgttgacccgagtgagcttctgtgatgccgaaagttcatgaggcacccaagttccaagttttgaagtaaaaccaaggcgacccaagtgacgtgcaattgtgctatgacaacactcaagcttctcttccatttcacgaagactaagacgaggctcttcctccaccagcttcactaggtcttcttcatttaactctaccggtcgcccagaacgttctatttcttcgagactgaagtcgc