Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.1   

sjj_Y18D10A.1 RNAi JA:Y18D10A.1
Simmer:Y18D10A.1:Screen_A
Simmer:Y18D10A.1:Screen_B
PCR_productsjj_Y18D10A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.1 Source_evidenceePCR1126WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.1 Source_evidenceePCR1126WS150 Sequence/Annotation Release
Chunk_score Abs_score1105
Max_abs_score1105Y18D10A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1279580712796941
Overlaps_transcriptY18D10A.1 Source_evidenceePCR1126WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.11135catcatcagaagttgttgagctggacggagcaggcaagctaatcttaattttcggcggaattttcctggcaatcggcaactttcgagcttttggtggttcgggctccgaggcttgttggtcagccaattgattatcgatttttgtggcggccggagcttttggtggcaccgaggcttcaggtggagcctccacacttgtgctatcgatttccggcgaaaatattttgacgactgcaacaactttttccggtttcactgttgccgtagaacttggctccgatgcttgaagtgagtcagaaatgggcggagcttcttcttcttcttcgacaatttccatcccccgttcttcttcttcctcttcttcatcttcactatcactaatatctaatccatattttgaattcagaatttgtttcggactttttggagtttgttggtggacagaagttggggctgagtcagaaatgggcggagcttctgaagaaattttcttttgatctactggtggcatttttgtagtttttgtagtttttgtagtctttgctccagaaagaatttcactgagcaagtcatcgacaggcggagcagctgagcaggaagtaggcggagcctggacagaagtaggcggagcttgttgcgtggtagatgaaatgctcttttgaactgctggcggcgctgcttttctagtttttgtagtttttgctccggaaagaatttcgctgagcaagtcgtcgacaggcggagcagccgagccagaagtgggcggagtttggctagaagtaggcagagcctgtggagctcttccagaaatttctgaagtagttggcagctcggcagtaggattttcctgagcttttggtggctctaaagctgtgggggaaacagtgggcagagccagagccagagccaaaatgggcgtggcttgttccggaatatcgattttcggtggctcagctgaagcttctgaagcttctggaactggcggagcaggatttttagtcaattctggagcacttggcacagtgccagaatgttcttctgaagcatcaaattgctcgtcgagcagctcacttccacacgaaattcgcggctcctgctgggaggtctgttgtggtagatcgagggtctgaaaaat