Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.13   

sjj_Y18D10A.13 RNAi JA:Y18D10A.13
Simmer:Y18D10A.13:Screen_A
Simmer:Y18D10A.13:Screen_B
PCR_productsjj_Y18D10A.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.13 Source_evidenceePCR973WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.13 Source_evidenceePCR973WS150 Sequence/Annotation Release
Chunk_score Abs_score932
Max_abs_score932Y18D10A.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1288934012890877
Overlaps_transcriptY18D10A.13 Source_evidenceePCR973WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.131538caacatgactgacaaggatctgagcgcattcgacacttcggagattttcagaccatctacagaatcagtgtcacgtggaactggagctggagccgccgccgccgccgccgcagctggagcatcatcaaaagatacaatactcccgggtactgtatcatcggcaagctcgacaagctcagctgccggtggaacatcatcgttgttcgaggaaatgcacacacatatgctgctctatggagaaagtggaaaagttgtggatttggcgcgtgccgagaccgctttcagaattctcactgcactgttggcaccacgtggagccactggaaatcggatgctcttgaattgtcttgtttcgtctggaactacaacgacgtcggattccagtgctgagcacagtttggtggagcttatgaatcggcatgttcgagcgattctcggacagcatttctggtcggcgcccgcgtccgatgaggagaagcataagcatattacgttgttggaactgttgattacggtaggggtgtagtttgtagtgtagcttagagtttagttgtagtttgtagttatatcattatggtagaagtgtaaaagtggtgtagtttatgttgaatagcgatataactaatatagttaaggataattgattattgcacgtggtgtcaaagtgtaccattttggtttgatcttcaaaaaatgcgggagaagagacgcagacttttcaactaatttcgcatggttaagcgtgtgctgacgaaaaattcccgcaatggaacatccttacaccacgtgttattgtattttgtagtcaccagcatggctatagattgtgcaagcgaattgtaatttgtagtttcaaacaattttacaatacggcaaaataaggctagataatatacatttttgcagatctccctccacttcctgcgttcctacttcctcaactctccaatatccccagtcacggaagccgacttaacatccctctggaaatgcaaaatctcggcattggaattcctgtgcgaactgttccgtgagctctcagcaatgctcaatgagcacgaatcgaaacaattcgtacaattcgtgcagaccattctgaatcgatcgaaacttcagaaatgtatactccatttgttgctcaccgccgtagatcataatccgatggagagcagtagtagtaagaagacgggcggtggtggtggtccgttgtcagtgtcgattagcaagttcaatgagggtctactgggagaatcgagacgtctttcgccgttgctcgccgcctaccatcggagcctgctcacgttcacgtctcatgcgattcgtctggaatgtgatattaaacggggattcgcaacgttttctgatgtgagcagaatgacacttgtggagcaatagtctgggctacaaactatagtgtagtttatagtcatctgaaaacttatagacttgaatgatagcttattacacttcaatttgttttttttttctttgtagtgagtaatttaaatcagttttcgaatacttgacaacaatcacca