Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.16   

sjj_Y18D10A.16 RNAi JA:Y18D10A.16
Simmer:Y18D10A.16:Repeat_b
Simmer:Y18D10A.16:Screen_A
Simmer:Y18D10A.16:Screen_B
PCR_productsjj_Y18D10A.16
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.16 Source_evidenceePCR291WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.16 Source_evidenceePCR410WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1290294412903952
Overlaps_transcriptY18D10A.16 Source_evidenceePCR410WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.161009ccaattaggcgaaaagttcaatattttgcgggaaattcccaaaagccgaatccacaggcccagcttagcgatacgatgataattctcaagtttttaacacattcttcctggaaaatagatttatacacgtattatattatagagaaagctgaaatcctaaaaagaaagtaacaaaaaatatgaaaattttcgaattattcgctcaaagatcgcccttccttcctcggaatctcgatctcatgtccaccagtgatcgcttgcagtcggtgaaattttggagaacggcgaaacatttgtcgggtacacttccgtcgccacgtgcatcgatgcattccttcgcagatcgagcttgaacttgcacacaatgcgagtttttgatgcattttttgagtgcttgacgtagacgatcacacgatacaccggtcttctttatctcgttgaattcgtcttcttcaaattgttgggattgggagtgtgcggtgattccggccatttttcgcgggagtttgcctgaaaaatcgaataaaaattgattttagaagatataactagttttaaacaataaaatttaagtaaatttcagtctttttcacaattttatcacaaaaaaacgagaaaattcaataaattcgcacaaaaattgattttatttcatttaaattttgaaaaataattagtgtcgatttacggagttggcacggtgccaagatttgcagaatcgtggcgagacccacaaaaacctatagcaaaacatgcgcctttaaatgggattggggtgcagcgccattttaggatttttgttgttttcttcgcaaaattgttgatttttcgttattttttttgattttctagggaaattttcaatgttttattgctaaaataattatttttgacgtgatgaacttaaagttacagcttagaatcattaaattttgcgaattttgatagaaacttcccattttttgtgattttcaagtttgagcttaccttttatttcttctgccgattt