Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.17   

sjj_Y18D10A.17 RNAi JA:Y18D10A.17
Simmer:Y18D10A.17:Screen_A
Simmer:Y18D10A.17:Screen_B
PCR_productsjj_Y18D10A.17
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y18D10A.17 Source_evidenceePCR957WS150 Sequence/Annotation Release
Chunk_score Abs_score873
Max_abs_score873Y18D10A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1290440012905561
Overlaps_transcript Y18D10A.17.2 Source_evidenceePCR956WS150 Sequence/Annotation Release
Y18D10A.17.1 Source_evidenceePCR957WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.171162ttgctcttcgtctttcttcaaacgttgtgaaacttaaattatattacatttttgcaggtaataatgtcgaatcaaacaccgtacatcggaagcaagattagtctgatctccaagctcgacatccgttacgagggaatcctctacaccgtcgacaccaacgactctaccatcgcgttggccaaggttcgctcgttcggaaccgagaagcgtccaactgctaatccggtcgccgctcgtgatgatgtctacgagtacatcatcttcaaggccagcgacatcaaggatttgatcgtttgtgatactccgaaggcgagttgccggataatcgagcttcattgatctaaataatgtcttttcagatggccaacattggaggagggcttccatacgatccagccatcatctctgtctcctcgagatcagccccagcaagtgacggagctccagctgcctctgcaggttcttccagagccggaacgccatcccgtaacagtccgttaggccaaatcatccaaaatcaacgtccaggacgtggaggttatcagcaaagtcagttttattttctttcaaatcaactctggatttatgatcatgttttcagacttccaagctaaccgtggatacaacaactaccgcggaggattcgctggcggatacaacaaccaaagagggcacaacaattatggagttcctcgagttaatcaccgcgaaaagctgaagttcgaatcggactttgacttcgagaaggccaatgagaagttccaagaagttctcgtcgacaaccttgagaagctcaacattgaggataaggccgagccagaagttgaggagaagaaggatgctgccttctacgacaagaagacttcattctttgacaacatcagctgtgaatcactggagaaagccgaaggaaagactggacggccagattggaagaaggagagagaaacgaatcaggagacgttcggacacaacgcagtgcgttcgttgaactaccgtcgtggattcggaggacgaggacgtggtggaaaccgcggatatggaggtatagttccactttagaagttacaacgtcttatgctcaattttcaggttacaacaacggataccagcatcaacaccagcaccgtggaggatacaatggaggttatcgtcagaacaa