Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.18   

sjj_Y18D10A.18RNAiJA:Y18D10A.18
PCR_productsjj_Y18D10A.18
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.18 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.18 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score729
Max_abs_score729Y18D10A.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1290650712907682
Overlaps_transcriptY18D10A.18 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.181176ttgaagagacagcgaatagttcccttaactcctccatctcgggaaatttcgaatccagaggcattcggatcgaaaactctcgcagcgtccaaactcatacccatgcagaattcccattttttgaaatttgtggacttcatgaggcactgaaaagttatttgaactagttacaagcagtgtaggtggaataacttacatttttgatttcaacagcctttccaacagtaaccaatttggcatagcgatgataattccataaatagccaaacgtcgacggtattccaggagcacattgatcacggattttgatattttcaaattgctcaaactttttgaacggatttttgaaaaaaagttaggaaatttcaaccgattttgccattttccattgatccaatttatacatttccttcattgtttctgcattaaatgaatctgaccagagaaattccaattttcctggcttgaaatgacggagaatcgatggagtttgacgagagttgagaccgaacaaatgaatcttttttaaatttggataggccgattgttttagaattctttcgattagtttgcagcagtatttggagaagtcttcataaggcgcacaagattcgccgagataaatttggaaaatctccaacttcgctttcgggtgactcactcatcatcttcgtcacgaacttcataacaacttccaatgaatcttctccattaccgaacttccatttaagcatctttcgagggttgaattttgaataatgagtggcattgccggattccttcacaaaatagaacaggttcgagtcaaactcgacatcaaacgcttccggttcataaatacaaatgcggatcttcttgaatccgggatccatcccatcgaccgcatttttgaactttcggcacacttttcgaagcggcattctgaaataagaaaggcatttggataattatttgtaatttaggtatttattgcataggattctgctttgatctgctaaactataaaatcaaaatgttattacctctccagataatccaattgtttgaaacattcgtagagggcatccattggcagatcggtaaatgtcagttttgatttcgatctggaaaattatgagattgaatatgtagacgaatttcagattgaaaactcacaatttcatggaatccaatttg