Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.19   

sjj_Y18D10A.19RNAiJA:Y18D10A.19
PCR_productsjj_Y18D10A.19
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.25 Source_evidenceePCR873WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.25 Source_evidenceePCR980WS150 Sequence/Annotation Release
Chunk_score Abs_score833
Max_abs_score833Y18D10A.25
Specificity_index0.902
Rel_score1
Map_statusUnique_ePCRI1291629612917994
Y18D10A.19 Chunk_score Abs_score90
Specificity_index0.098
Rel_score0.108
Overlaps_transcriptY18D10A.25 Source_evidenceePCR980WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.191699ccaagaatctgctctttttctgaatcacgaaaaaaaattcaagttttctcatttctctgaaatgattcgctttgctccttaactgcaatggagtggttgattcgaatcaagttgaaaaaacataaattttagtatccgataacatcgcgaaataataagaaggagaacagcttcaaacaatatcaagcaacatcagatgtagaacaatgaaggaccaaaatggagtagcaagcactgatgactctgttttaccttcttggagtaacccagacgtcggacaattcattgtgtcgacgtacaatgagtacgaatacaaacggatcccatttcgtgaactggaattcggatgtcttctatgcaggatgagaacattcaatcacgaaggaatgaaaaaacacttgagggatcacgtagtccacaaaaaatcttcatgtgagcacgaaaaaccaggtaattcgcattttgtgtgaaatgtacactcaaaatgaaaaactgcgtggcacgtactgcagaaaacataatatttaggccccgcctttttctcgtccactcacggagaaaaggcaaaaatcggaacccaaccaatatcaggccgccgacatctcacgggtaccgcgcgccgctgcgtttaactcgctgtgggcgtggcaagttgtctccgtgagatgtcggcggctgatattggttggaatcccgatttttgccttttctccgtgagtggacgagaaaaatgcggggcctaactaaatattaggttttctgcagtacacgccacgcagttttttgttatttggagtgtagaagatatataaattacaaaaacttttcttatttttcaatcagaaatcttctatttatttttaggtaaaactggaattcatcatcaagttgacaaagctggaaatggtgtaatgccagagaatgggcaacttgttcagtgctacatcgaaattaagcttgcggattgctacacatcttggtccaattacgagagccaaaatccgattatctttaaaattggattcggtgaagtcattcctggtttagatatcggaatccctaaggtatgtacatttttattgattttttgcagaactcaatttttataaataaaaattcaatgttctttcagatgaaagtcggtgaaatcgcaacatttcacgtgagtggcaaatatggttacggccgcgctgggttcagaggactgattcctcgaaacgcttccctaacttgcaaagttaggctgttcaattgctcatgggactcatatggtagatttctccttatttttgagttataaatcttaatattccctctttttcagcaaaaattggcgtcgatagacagattctcgtccagggcgacaacgtcaccaagtcaaagaacggtcagaccgtcacctgccactacgtgctcatccttgtggacggaacgaagatcgactcttctcgcgaccgcgaaactccattcaagttcaagattggaaagggagaggtcatcaagggatgggaccaaggagtcgcccaggtttgtacatcgattagctcaatttcaatataaaaattcaattttctttcagatgtcagtcaaagagaagtcgaagctcacgattgctccggcttttggctttgaaaaaggcaaattgccagcaggaatcccagcgtaaaataaaacgaattggatacatgctgcgtacttt