Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18D10A.4   

sjj_Y18D10A.4RNAiJA:Y18D10A.4
PCR_productsjj_Y18D10A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.4 Source_evidenceePCR477WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.4 Source_evidenceePCR477WS150 Sequence/Annotation Release
Chunk_score Abs_score435
Max_abs_score435Y18D10A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1281581712816633
Overlaps_transcriptY18D10A.4 Source_evidenceePCR477WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18D10A.4817tacttgggaggttgtgtctgtctagctgtctgcgtatctcctctctctctcactatgtgaaagagacacagagaatgacaggagagagacagacagaggcagtcagtaagcgatcgaatgttgtgtcagagagatgtggggggccgccttgtctgcgtctcgtagacgggcggactctgagtgtctgcgtctctgatgactcatcacacattgatggatctatcggttaccatttcttctccttagattgcctctcactctctctcactctctccactgctgctgttgtggctacagctacgtcgtcgtcgtcatcgccgaaggcctttggggtgtcggtttctctgtttctctggagccttttggttgcttggtatgtggttggcgtgttgctagttactggaggaatggacagagagaaaatatatgtatggcaggttatattttatatagctttaatgtcatgctattgattatttttccagttctttcacagattgccaacgaagcggaaaattgagaattcctttgctttttcttcgttctttttttgcttcctgaagcctatgattataggcttttggacactctcattctgaaatatttgaacgagattcctaccgttttttgatttattttccgccgatccgatggattttttttttgcatcacgagtgttagacggttattttttaacagtgtttttcgaaaaaaaaaattcaaacgttaatgaaattttgaggaaatttttctttaaattaaatattactttctcggttttttttcctggcattttttgtaaccaccacgaattttc