Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y18H1A_67.j   

sjj_Y18H1A_67.jRNAiJA:Y18H1A_67.j
PCR_productsjj_Y18H1A_67.j
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18H1A.9 Source_evidenceePCR640WS150 Sequence/Annotation Release
Overlaps_Gene Y18H1A.9 Source_evidenceePCR640WS150 Sequence/Annotation Release
Chunk_score Abs_score537
Max_abs_score537Y18H1A.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI752268754674
Overlaps_transcriptY18H1A.9 Source_evidenceePCR640WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y18H1A_67.j2407acctgttgcctgttgaatacactttggtggtgatcgattctttctccacagtctgatctccggatcattgctacttctactgtactcataaccatccggattcagcagtggaacaatataccattcgagttgatctacgaattgcttgatttgaacatctttgtcgtactgggtgaccagttggtgaatgaaatagagtactgtcgatggtgacacccattcacgagcatggattcctccgtccacccagatgccacgtttcgtacctccgttacgcttgttggtgatctggaattgaggaaaattggggtgagatgggatcactaaattctgaatctagtttctgtgctactgtgtgttacgttttttgcgctccattggcaatcgcctgcccatcaaaaaccgtcaaaaagtggcaaaactgggcaatttttgtaaaaattcacaattttgaaactcctctaaaatggtttagttcgtagctagaggacttaaaactgatttttgaaccctaaaaattgtctaaatttgttgaaaacgggtaattcttgtatgctgaattcagaaaatctaggtttaacccatcaaaaaccatcaaaaagtggcaaaagtgggcaatttttgtaaaaattcacaattttgaaactcctctaaaatgggcaattttgtagctagaggactcaaaattaacttccaaactctaaagaattgtcctttttcagaatatagtggtttcaataattttcgaacagaattttttttgcccaaaaaaggatggctgaaaaaaattttggccgaaaaaaaaacagttttacactgaaagccaaaccgcgacgcgacacgcaaagctcggtaaatcgaccccagccgtggccgagttcaaatagccaaattcggcaaactctcacatttcaagctatgtatttcaagccagaagcgcgtgcgatttctcaaaaaccggcagctcagttgcaggaggactttacgaaaattttgaaaattccaaggtataattggtaggtttttcggcatgttgcatggtacttaaaatgtttttttaactttcaaaagtggcttttattttggttcttattgcaagcctaataataaaaatactatccacgttttaaatgcttccatggtaggcaggcgcggtttcagggccgacatggaagccctacatgtcacggatttctggctttcctcagaaattgaaatggactagtttttgccgaactaggccaggccatatctggggtagatttacggcgcgttgcatgtcgcgtcgcggctcgattttagttgaacaactaaatgcatttgtccgagtggagtacacgactttcccacgcgggcgattgccaatggagcgcgaaaaattcaatgaggagggccagaatcccgtgatcgtccgaagcaaagttaaaacaacaaaccttaatcaacgggatctgccgtccttcgtgagtcgttccgattggctgcacagacacaagctccggataagtgatggctaatgagttcaggtagttgataacatcagcaaacgagtgatattgtgcaaggttaaattgaacctgcaataagttatcattgaactatgtatcattgaacgtggtgtcagagtgcctcattttggattgatctacgctgatctacaaaaaatgcgggagaagagactgatttcgaatggttaaaaacgtgctgacgtcacattcttttgggctaaaaattcccgcattttttgtagatcaaaccctaatgtgacagcctgacaccacatgtattcactcactttctgctccctccaatcatgcagtcgaacttgtttccgaagcttatcccgcttctccttctgctcgacaatcactctgaaatcgatgaaaagattgtaagttgggcttaatagtgtccccccacgacacccatcacgcgtaacgagccgtgacgcgtttgaataaagagggtatttggacttgtgatccccgcgaaaacctgtatcgcacgtgatgccagggtgtctcatcacgggttgatctacaaaaaatgcgggaattttttgcccaaaaatgtgacgtcagcacgttcttaaccatgccgaatcagttcccgcattttttgtagatctacgtagatcaagccgaaatgacacactctaacaccacgtggtatcgccgaaaaactcacttctgaacgtcatcaatcataacggaatgcttaatcgaatgatcatcgagctctttcataaactgctgagttttctcatcggatatcatcacatgaacctccttgccagcttccgacggggatttccaaaaatctagctgaaaattttagtgtgtctgaagcacccttatcagttcatattatatttcaaaatttttctctaacccctcaaaaccgtact