Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y19D2B.1   

sjj_Y19D2B.1 RNAi (4)
PCR_productsjj_Y19D2B.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY19D2B.1 Source_evidenceePCR258WS150 Sequence/Annotation Release
Overlaps_Gene Y19D2B.1 Source_evidenceePCR258WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusUnique_ePCRII1092244310923486
F44F4.11 Chunk_score (4)
Overlaps_transcriptY19D2B.1 Source_evidenceePCR258WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y19D2B.11044cattccaaaagcttctcattttgggattgaatggaataggccattttccccctttctttgtaaaaaaatctcctccaatcaaactcgcaattgttaataatttaaacactttatgatacataagtatttaacagtgaacatttcaatactcttctccgtcttcttccaatccctcgttggaatcagctccgacctcttcgtagtccttctcgagagctgccaagtcttcacgagcctcagtgaactctccctcttccattccttctccgacgtacctgcaaataatcgatattttgtgtttcaaacaactcgaatcttaccagtgaacaaaggcgcgcttggcgtacatcaagtcaaacttgtagtccaggcgggaccaggcctcggcgatagccgtagtgtcggagagcatgcacacattatgaaatggaatgaaactgaccatttatatgcaaaattagtagattttataaactttgaaaatgtatatctggcttcaaaataacttgtaaagaaattcccgtagccatttcattgcgaattttgtgttctttcagcatttaaaaacggcattccaaaagcttctattaccgccgcgttcaaccagaaaaattacattttaagtcatattttgtggagcacattcagggattgaatggaattggccattttccccctttctttgtaaaaaaatctcctccaatcaaactcgcaattattaataatttaaacactttatgatacataagtatttaacagtgaacatttcaatactcctccccgtcctctttcaatccctcgttggaaatgttgtccaggcgagaccaggctttggcgatagccgtgcggatgttgctcctagggagctaatctcaattttcaatggatctgaaaattttttcaagcttcctcgtagaaaacccaaaaacttgttgattaattttaggtgcatctaacacattttcgtaactgaaatagttgaaattttcaaatctggcacatttgacaaaatctgtcaaaacctacagaaagtgctccttcaaa