Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y23H5A.3   

sjj_Y23H5A.3 RNAi (4)
PCR_productsjj_Y23H5A.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY23H5A.3 Source_evidenceePCR924WS150 Sequence/Annotation Release
Overlaps_Gene Y23H5A.3 (3)
Overlaps_transcriptY23H5A.3 Source_evidenceePCR934WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y23H5A.31157tctcggcctgtttcttcagttttcttgtaaaatttactgtttaattaataaaaatgtacatttttcagaaaatggttgcccatcagaaggcggatttcaagtcgaaatgggcgatggtcgtgactgtcaataacctgaatgacaagaagcgagccgatttgagagaattttccgagtggtttatcgagactttgagattggaaggagcttttattggtcactatttcaattatgaggttattaagagttaataattaattaattataaatgcaataattccaggctgcaccggtgaccatcgtcgagactttgccaggcaattttgactcatgcactaatgcatatcagaagattcacaaggttttgatggataaattaaataaaattcaattaaataattcttcaggagcatccgcaggtcgtcctcgtcgtgcacattcttccacagtcgcagtcgaacgagtacgagtggatgaaggtgttggcgtcgagatacggattcgtccgtcagggattgctctacgataactgtgccaatcgtttccaaaatgtggaaaccgatcagaatagcgtgttccggaacatgtgccaatggatttatcgtagcggcaccgcgattgtgagaaatgagggaaagtaagtcgaattacatttttttatttagccattttttatttaattcctgtgtgtttcagcgcgtgtggaattctccatggaaaagatccgaaaccgacgttcgacaaggttctcttcaacagcgaagacatcaaggattccgttttcaaagttcttcacgccgaagaagagccgagaggtgcggatcaggagaacatgctgaagatcagtggatatccggggatgctcaacacgttcggcatcgcacaacttctcaccccatatcgtgtcaatgggatcaccatcaccggcgcccagtcggccgtcgttgccctggagaacaagtttcaagtctatcaggccgtgcaggatttcaacgggaagaagctcgatcgcaatcacaaacttcaagttagcagcctcgtcgtctcgtcgccagccgttccactcgagtggccatcgctcaaaaagtcgaagaagctcgtggagcaagtgggaaagccgatcagactttcgaaagtctcctcttaaatgtgcccca