Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y23H5A.4   

sjj_Y23H5A.4RNAiJA:Y23H5A.4
PCR_productsjj_Y23H5A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY23H5A.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
Overlaps_Gene Y23H5A.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772Y23H5A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI26175812619218
Overlaps_transcriptY23H5A.4 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y23H5A.41638acagcgaagcaagcaattttattacggtaagtgacgtcactccccgtaaactaggccacctatgacgtcattcagaccatgccgctggtgacaccgcaactcagaagcacattagccacgagaagagccagatcaatttggaaatgactggcgagccaggaggaggggagcgccgatattttgaagggcttgttggaactaaagagcttgtcatattatctgcactgaccatgtgcttgtacttgatcaatggagagtatgcacaggttattgattttttgcagccgccatctagttttctgttttcagacaatttgcaccgcgctgacgtcagtgccgccggctcttttttcgtatcgagttttgacaaatcagatgactgataagcagggatatgtgagtttcgaattccactacgtggtcgcgaaaaaaaaaactcggccaccaacgtaatacaccggattttttcctccttcgtttgcgcgtaaaacatggtgcatcgatgtcggtgtaccgcacggccgtatccacttctggctttcttcacattttgaaatggaagagtttgccgaattaggccattttgtctcggccacggtcggggtaggtttacggcgcgttgcgtgtcgcgtcgcggctcggttttcattgtgaaactaaatgtcttgtccgcgtggagtacacgacttctccacccgttgtccggttggcgattgtcagtggagcgcgaaaaatgcaatgagggagactggaagcccgtgtacccatatttttcacagggttctggcctgcctcattgaatttttcgcgctccattgaaactccacaccgacaaatacatttagttttacaactgaaaccgagccgcgacaagacacgcaacgcgccgtaaatctaccccaaatatggccgagctaaaatggcctagttcggcaaaaactcttccatttcaatttatgagggaagccagaaatccgtgaatagtccccatataattttggtggaaatgttctaaaaatcgaaaaatccactaaactaaagctaatttttccagcactcaattctgttctactggaccctttacgggctcactgctctaatcgatcaattcgctggaacagctcaaggatacaatctctgcaagtgtggcctccttggcgtatttttcttccacgcggtccgctccaacttgtccgcagtgcccgccacctggaaattcgcggagaagcttgaagttctgacgtcactggtttcacagctggagactgatggttttctgcggaactacgatgcgatgacaccaacgataacccagttttctgaggatgactcgctgcaatacatattcccagtggaagagaatttggaaatgagcacagcgtgcagtttcgtgccgtcacttgatatgcagagcacccagaatccgtctccatctactttgaaaactatgaaaatcgaggaaagccggaatttccagaccatgtcggcgatgacgttggcctgcggtggagctgcagcagatattgtcaccgtgccggccgaccggatcacgtttgccgctggcaagctggaagaagttattcgagtcactaacgtctcgcaatcgcatattatgttcgctttgaaggtgaggtctcg