Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y23H5A.5   

sjj_Y23H5A.5RNAiJA:Y23H5A.5
PCR_productsjj_Y23H5A.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y23H5A.5a Source_evidenceePCR523WS150 Sequence/Annotation Release
Y23H5A.5b Source_evidenceePCR523WS150 Sequence/Annotation Release
Overlaps_Gene Y23H5A.5 Source_evidenceePCR549WS150 Sequence/Annotation Release
Chunk_score Abs_score488
Max_abs_score488Y23H5A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI26138752615204
Overlaps_transcript Y23H5A.5d.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
Y23H5A.5b Source_evidenceePCR523WS150 Sequence/Annotation Release
Y23H5A.5d.1 Source_evidenceePCR549WS150 Sequence/Annotation Release
Y23H5A.5a Source_evidenceePCR523WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y23H5A.51330agtttttaaagttctaggcccccaatggaaaaatacgtctttttttaagatcacatattctaggccacactttgccacccgcggactagttttttcatttttcttccgctggaatgccggaacagatcaattttttcgtttccaggaccaacaaaaaatggcgaaagtcggattagagatgaagcttcttacatcagaagtcgacgcggaagccgaaaaatgggatgagtatgccgagaatgacatagtgaaacgggccaaagcaatgtcatcgatggcctataatatgtacttatttacacgtggagatggtcctctgaagacgacacacgacctcttcacccaggcggagttctttgccgagcaggcgaatcagatgtatcggacagttcgagagttctcatatgaagttccgggctctgcggaaaaatccgatttgtcagcgattcttgagaggatcccacttcactgccaacagctacaggttatggttaagagtccgaccgtcggaaaaactgcgactttcgggaaagtggattcggtgattcaggagaccaagaatttgatgaacgaaatcgcgaagctggtcactgcgtcgtttgtgtgtgccacgaaggtgaggaaaagcgctctgtcgagaattattaaatgagggagagaaggtggaaatgcgctctaccgcaatttttttttggaaaatcgatctaaaaaatctcagaaaaagtgtatcggagtctcacccgaaagtcaaattttaaaaactttttttcgacttcttaaaatttcaacaaattttccaccaatttaaaaaatcggtaaccctccctgcggtggccgtggactaactttccacttctcttccaccgcgttaatcgggaagccgttacccccatttctcaaaaaataatagaaaaccagttcagatgttccaggactctcagcaagggtaagtttgtccctagcgagtcatttgagtagagacatgtccctttaaattccctcggtttttctcaaactactgctttttcagtattctccctgaatttattgtgtttgttgagaaaattttagcgaaaataatttttttaaaaactctgtaaaaaatcaatttatcgattaggttgcaatatgtgatcgttttgtaatagctgaactcattttgcacaagctaaagcaggacctaatttttgtccgttttttcagtatgaaatcgagtttcgcggaggttctgtcaatgggcggacgggtgccgacggtgaaaggacaagtcgcgaatcgactgtgagtttattgatttttttaaaaaagggaaaaatcgatagagctgatt