Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y24D9A.b   

sjj_Y24D9A.b RNAi (5)
PCR_productsjj_Y24D9A.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY24D9A.6 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene Y24D9A.6 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432Y24D9A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV43998604400932
Overlaps_transcriptY24D9A.6 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y24D9A.b1073cttctttcactttcaccagtcgttcggttcgcaaactgaattccgtgtccttctctcccactctctttgagttttttcgtcctcgtcctcgtcgtcttctccttctcctactgtcgttttgtgatgacagtatctagaactagtagatacacagcattgtcactcactgaaactggcctacattcctttcttcttcttcttcttcctttccaagcacacacagagacacctatcaagtacattccttttcactcgattctttgacagtacgttcgttttcgcccacacggaagatgtatatatggaaatggaaaattggcaaattgattttataaaaattgaaaattttcgacagttgccgaatttcaaaactttcgccaattggtcaattatggagtttagaaaaaattggaacaaaaaactcaaaaaatgagtaaaacatgttttactgtagaaaattttttttaaaggtgaagaacacatgaaaattaggcaaaaaatgaattggccatttttttttcgataattcggcattttcgggccaccatatagacttggactttgaaaaaaatagctttaaactttcaaaaattggtttcctcaattttgcgatataaaataacgcccacttttcggcaaattttgggttttttttcgcttttttcgccaaaaaagtcggctgaatttccctaaacatcgggaatcgtagatctggacaaatcagtcctaattaaaaatttttggaatttttggaacaattaaatttgttcataacggcccttttctatataacacctaaaaatatataactattttctcttcccttgatgacactagttctccccttcccgaggcagtggaaaagaaaaaaaaaagaaaaaaacacacagaaaaaaaaatggtaaatgtcacgaaaattagtgttttgtggaaccgaaccttttagattgaaaattgcgtcaaaaaaaaacccctcatactgataacaattcttctatgttttgtttcatttttccctctttctctcttcgtttctcgcctccaaaagttgtgctgaattgtcaaagttttcc