Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y25C1A.9   

sjj_Y25C1A.9RNAiJA:Y25C1A.9
PCR_productsjj_Y25C1A.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY25C1A.9 Source_evidenceePCR777WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcriptY25C1A.9 Source_evidenceePCR777WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y25C1A.91610acttaggacctcttaggacccctacagtacccccgtccagtcggcctacctgcgtaaaagcgaacaacgccgtctgaatacccattattaaagtgaaaattgtcaggtatctctcaacgtttttgattctatattccagtattgttaggccatatatggtgactataaagaatatggtaactaatacaacacatgggatacagtggaataggtgtaggaaggagatgttggcctggaagctactgctggtaatttatagaacgtggtgatgagtacccatggaatcgcatccttgtagttgacggaaaacccagcaccgtttggattaatatacaccctagatagtaggatattccagattactccgagagggagcacaaattgagcaatcaccattggccatagtatccttttccataactgaaacagctagttttttgtcagaattgaaatcccccgattccttacatgtacgtgccgaactggaagaataacacatgtcattctattgaagctgactgcaatttgcgataaagtcttgaatgccagcatataatggttgatagtgtaatatgctttggtaattatagacggggtgaagaagtatggtgcaacgagtgggcagagtggagtgacgtcactgaagagtcggctgaagaatacagcgacacaggaggtatagatgttctggaagaggagttcaaaagtttgggattcgggaacactggccaatacatccatagcaggcgtgggcggcaaacggggttctccggcaaaatggacaagttgccggaattgaaaattttcggtaggccggcaaagtgccgaaaccgaaatttcccggcaaatcggcaaattgacaaattgccggaattgaaaatttccggctaatcggcaaatctgcaaactgccgaaaatgaaaatttccggcaaatcggtaaattgccgaaactgaaaatttccggcaagcccggaattgaaaactttcggcaaattgacaaattgccggtattgaaaaataccggcaaatcggcaaattgccggaaatgaaaatttccggcaagtcagcaaatcggcgaattgccggaattgaactagattgaaaaggcgcctggcagtgacctacgggaccttacggagactcaaaatgctgcctaaatgacgatcaactgtggcccgcctgtggtccgttttgagccatccgcgggcttttgagctgccaatgggccgctttcctagctagctaacattgccggaattgataatttccggcaaatcagcaatttgggtaactgcttcacgttcctggcaatggcttactaaagaaaagagctaaaactcaccactacggcctctgtcgtatacaaaatgtaaaacgagttgtttcgataatgttctttatttttcgacttgaaaattgtattaagaatcagcacattgagaatagcactgagaactagatagctggcttgtatcaggtagtagagaatggaaagctttacgctcgggtcttcattgcaagtgaacggaaggggatcggaataggaaaagttggcgggtagggtgaagctcatggtgatttgagaaggttttctgtgagttgaggagtg