Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y2H9A.4   

sjj_Y2H9A.4RNAiJA:Y2H9A.4
PCR_productsjj_Y2H9A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY2H9A.4 Source_evidenceePCR826WS150 Sequence/Annotation Release
Overlaps_Gene Y2H9A.4 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score763
Max_abs_score763Y2H9A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1344949813450637
Overlaps_transcriptY2H9A.4 Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y2H9A.41140acaaaacagatagggactgaccaaccaaactttcaaataactatcaatttatattcaaaaaggctaattatatctgaaaattctgtagtttctgaaaaatcttttcacatttgaaactaatttctcaaaatttcaaaagtagtttttgaatatatacatacatttttttccgttcaacatctattttacagaattccaagtagtgatcctgagaaccctccagatggaatttcgaacgggcacacacataactttagtggctcaactgatggaaaacatcacggactgtccccaaaacacatatctagtattaactatgatattgaaaaagcagaaaatgaaaagataaagactaacgaaaaaaatgtgcaaatttatcctgccaattccaaattcaaaacttgctctgacgaaaaactagataaaagtcgaagaaggtcattgcaaatcggcgaagaaaaatccgaaactgatgaaaatgaattgaaaggagtagatcaagataatcaattgccaaatacttcaagattttcactgcaaaacgaattggattcattagaaagaactctgcaaaaaaacataaaagttgatgttggagcccaactactcgaaaagtattcaaatgaattgacgaattttgttgcaaatatcacgattccgaaacaaaaagaggatatatttcgagaaacagaagaacgagagtaagtttttaaaaaatgaatatggatacatttgattttttgcagtaaccctagcaaaaaaagtgacagtgagaatgaagacaatgataatgattttaatgaaaaactgaagcaacaacaactaaaaaatgaagaagaactgaaaaaaaagaggcaagaaagagaagagagaaaggttggttaattttattaatgagacgtttttttctctttaaaacccttgaattttcagcgacaagcacaagaagaactaaaaaatttgaaatcagaatcaagagcaagactttctgctttcatgacatgcattcgtttaacaattcgatttgagcagaaagaggaagaatggtcagatgtgctcaatagtttcagaaagcctcttatcaaagctgttcaggcacatcatgatcttgtaaatgaggtgagaggatgtggttttgta