Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y32B12A.5   

sjj_Y32B12A.5RNAiJA:Y32B12A.5
PCR_productsjj_Y32B12A.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY32B12A.5 Source_evidenceePCR300WS150 Sequence/Annotation Release
Overlaps_Gene Y32B12A.5 Source_evidenceePCR300WS150 Sequence/Annotation Release
Chunk_score Abs_score258
Max_abs_score258Y32B12A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1648932416490234
Overlaps_transcriptY32B12A.5 Source_evidenceePCR300WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y32B12A.5911cccgtatctgttcccctaataacatcaacacatttcagaattttgacggcaagatttgcaatatttttccaatttgtaaccactttcaacgcaactgttcattgactattgtgctattttatgtcttcacaatatcgaggaacacagttggatgggtgggatgactgtgaaatggcgtaaggtcgacaacgaggtagttgaatttgcaaattgggctgactctgatagatgaaatcacttaagaagagctggtgaattcttgatgggagagagttgggctgcctggaaagaacatttttgaattttgtagattggaatttcattttatttctaggttcccgacactcacacctatggaagtaattatgaagttatggtagaaatatgacaatttgatttgatttatttaacttaactaaagcaatttacaacagtacaattgaatttgaaagttagacaagttactctttaaaaactaacaaaaagttcggcgattttggaataatctcagtttcttctagaagaccccagaggcaaatccctccttaccgcaatacaacttccattccgactcggaaaatacttgactggctcggcgagcaagttcagatagagcagttcttccgcccaactccattctttcaattttcttgagaaattgagttttgaatgtaacatacaccatcacaacgtcccttatgaggccaccgcaagccaccgaccttgccgtcattgccttgatagtttcatgatcggatccatggttctcaaattgctttcgatcttcctctgaaaccagctgtagctcttcttcgaggcttcgtgggtctgccatcctgaaatcataatgaattagtttaaagtttggaatgggagttatttagttgcccctgccatgttaccattttata