Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y37A1B.2a   

sjj_Y37A1B.2aRNAiJA:Y37A1B.2a
PCR_productsjj_Y37A1B.2a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y37A1B.2a Source_evidenceePCR297WS150 Sequence/Annotation Release
Y37A1B.2b Source_evidenceePCR222WS150 Sequence/Annotation Release
Y37A1B.2c Source_evidenceePCR222WS150 Sequence/Annotation Release
Y37A1B.2d Source_evidenceePCR222WS150 Sequence/Annotation Release
Overlaps_Gene Y37A1B.2 Source_evidenceePCR297WS150 Sequence/Annotation Release
Chunk_score Abs_score277
Max_abs_score277Y37A1B.2
Specificity_index0.5
Rel_score1
Map_statusUnique_ePCRIV1406666714067652
Y39G10AR.18 Chunk_score Abs_score104
Specificity_index0.257
Rel_score0.515
Y47D3A.5 Chunk_score Abs_score98
Specificity_index0.243
Rel_score0.485
Overlaps_transcript Y37A1B.2b Source_evidenceePCR222WS150 Sequence/Annotation Release
Y37A1B.2d Source_evidenceePCR222WS150 Sequence/Annotation Release
Y37A1B.2a Source_evidenceePCR297WS150 Sequence/Annotation Release
Y37A1B.2c Source_evidenceePCR222WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y37A1B.2a986tggacttttcgtttggtcttttaggatatatagatttaggagttagagggtataaataggacggacagaaactggacaatcaaaaaattaaaataaaattttaaaaatacctgctcatcatcctcatccgtccattcatcgtcaaaatcatcattctgtgatggatatgaagatctagtgacttccggtacagatggcgttggctgatgatgatgttgggctccgtaggatggtggagcagcaacttctgaagcgcctccccaatcatcaaaaggacgcgatgaggcagctggtggaccgcttgaagttggtgggagtggtggtggtaggacctggaatttttgagtatttatgaaattgtttaaaaagttagaaaattgaaatgggatctgtgtgtcatgtggtcccatcacggattgatctacaaaaaatgcgggattttttgcccgacaaaatgtgacgtcagcacgtttttaaccgtgcacacgtggtgtcaggctgtctcattgcggtttgatctacgaaaaatgcggggatacttttcaagaaaaattgtgacttcagcacgctcttaaccatgcgaaatcagatgagatgtctgcgtctcttctcccgcattttcgaagatcaaagcgaaatggtactgtgcgaaatcagtggataactctacgtctcaattcgcgcgttttttgtagatcaacgtagatcaagccggaatggagcactctgggagctacagttattacgtatacgtcacaagaaaatgggtctcgccacgctgacaactgtaaatcgacacgagtaacagaaacttgttgtcagcgtggtgagacccgtaaccaactactagagctctattttgtgatatggtacggtaggagtactgtaggattactgtagaataacaaaacaaatctgttgtgagcttttgtggagtctccagcggtgtcctatttgaggatcgacctcattaagtttggtagcga